Have you ever wondered why some people never seem to get the flu when it is going around?  Turns out that our genes play a role in both our immune response to the flu virus and the virus’ ability to replicate in us.

Simply put, some people are just more susceptible to getting the flu than others.

Both the H1N1 and H3N2 flu strains are going around this year.  The CDC’s interactive map shows that the flu is now widespread in parts of the US.

Genetic variants affecting susceptibility to H3N2:
A 2016 study looked at genetic variants in some of the genes involved in immune response.  It found that variants in IL17 (interleukin-17), IL28 (interleukin-28), and IL1B (interleukin-1 Beta) increased the risk of getting the flu. Keep in mind that even if you are at half the normal risk, you can still get the flu if you are exposed to it, especially if you have a compromised immune system.

Check your 23andMe results for rs2275913 (v.4 and v.5):

  • G/G: normal risk for H3N2 flu (compared to A/A)
  • A/G: normal risk for H3N2 flu (compared to A/A)
  • A/A: ~ half the risk for H3N2 flu

Check your 23andMe results for rs16944 (v.4 and v.5):

  • A/A: normal risk for H3N2 flu
  • A/G: normal risk for H3N2 flu
  • G/G: less than half the risk for H3N2 flu

Check your 23andMe results for rs8099917 (v.4 and v.5):

  • T/T: normal risk for H3N2 flu
  • G/T: ~ half the risk for H3N2 flu
  • G/G: ~ half the risk for H3N2 flu

Genetic variants impacting H1N1 susceptibility:

CCR5 gene:
The CCR5 gene codes for a protein on the surface of white blood cells. CCR5 is a chemokine receptor involved in our immune response. People who carry the CCR5delta32 variant are more resistant to HIV infection.

The CCR5delta32 variant has also been investigated in H1N1 flu cases. Several studies found a link to susceptibility and increased the severity of flu symptoms for people who carry the variant.[ref][ref] But at least one study found no link to disease severity. [ref]

Check your 23andMe results for  i3003626 (v4, v5) also known as rs333 and CCR5delta32:

  • Insertion / Deletion (either DI or -/GTCAGTATCAATTCTGGAAGAATTTCCAGACA):  possibly higher risk of flu or increased severity of flu
  • Deletion / Deletion (either DD or –): resistance to the common strains of HIV

CD55 gene:
The CD55 gene codes for the complement decay-accelerating factor, which regulates the complement system on immune cells. A variant of CD55 has been associated with severity of H1N1 infection. [ref]

Check your 23andMe results for rs2564978 (v4 only):

  • C/C: normal severity of flu
  • C/T: normal severity of flu
  • T/T: increased severity of H1N1 flu infection[ref]



The CDC recommendations include staying away from people who have the flu and washing your hands often.  Seems like some good common sense advice.

Looking for natural products to prevent the flu?

Elderberry syrup is a folk remedy for the flu and colds.  A randomized double-blind, placebo-controlled study found that using elderberry syrup (15ml) relieved symptoms 4 days earlier than placebo.  You can find elderberry syrup online (Amazon) and at local stores like Walmart.

A study (in rats) found cinnamon essential oil to decrease flu virulence and deaths. Cinnamon essential oil is often found in oil blends marketed to prevent illnesses such as DoTerra’s On Guard, which is available on Amazon if you don’t have a friend trying to sell it to you, or Young Living’s Thieves oil, also on Amazon. There is also an in vitro study using On Guard that shows that it might help against the flu.

More to read:
The Cochrane Review of Tamiflu (oseltamivir) shows that adults have an average flu duration of 7 days without Tamiflu and 6.3 days with Tamiflu. The study concludes, “Oseltamivir and zanamivir have small, non-specific effects on reducing the time to alleviation of influenza symptoms in adults, but not in asthmatic children.” Read through the study for yourself. To me, the risk of side effects from Tamiflu doesn’t seem worth it for a half-day reduction in flu symptoms, but I might make a different decision if I had the flu right now.

Leave a Reply

Your email address will not be published. Required fields are marked *

Related Posts

Diet / Gene Interaction

Problems with IBS? Personalized solutions based on your genes

We tend to take happy bowels for granted — until something goes awry!  For many people, a daily battle seems to wage in their intestines. Pain, discomfort, bloating, diarrhea and/or constipation — known as IBS Read more…


Wine Tasting Genes: How your genetic variants influence the way that wine tastes to you

When you think of wine, do you wax poetically about the subtle notes of springtime apple blossoms with hints or truffles — or do you just hope that all your friends can’t tell that you Read more…

Disease Prevention

The genetics of high triglycerides

Triglycerides are the main type of fat in your blood. Triglyceride is a general term for a type of lipid-containing three fatty acids (tri) bound to a glycerol.  Triglycerides are used by the body as Read more…