Headline news from two weeks ago proclaimed that the first genetically modified babies (twins) had been born in China. The CRISPR gene editing tool had been used on the embryo to edit the babies’ genome in such a way that they would be likely to be resistant to HIV.

I’m not going to go into the many moral and ethical issues that I think arise from modifying the human genome. I’ll link to some recent articles on the topic in the Read More section below, and you can decide for yourself what you think.

Instead, I’m going to explain which gene was edited and how you can find out from your 23andMe or AncestryDNA results if you already carry the mutation.

The gene that the scientist modified is the CCR5 gene. The modification made using CRISPR altered the gene to be similar to a natural mutation that is referred to as the CCR5 Delta32 mutation. Carrying two copies of the Delta32 variant confers resistance to HIV.

The CCR5 (chemokine receptor type 5) gene codes for a protein on the cell membrane of white blood cells, specifically T-cells, macrophages, dendritic cells, eosinophils, and microglial cells. It is a part of your immune system’s response to foreign invaders, and it is also an essential part of the way that the HIV virus is able to hijack immune cells.

Attachment of HIV to a T-helper cell. Public Domain Image.

The first person in the world to be cured of HIV, the “Berlin Patient“, was Timothy Ray Brown, an American living in Berlin. While HIV positive, he contracted leukemia, and in 2007 he was given a bone marrow transplant from a donor with two copies of the CCR5 Delta32 mutation. After 3 months, he no longer had detectable HIV in his blood.

The Delta32 variant is well studied on a variety of immune system topics. It is thought that the mutation first arose in Northern Europe and was preferentially passed on in Caucasian populations due to increasing resistance to smallpox.[ref] Others theorize that the mutation has been in the Caucasian population for more than a millennium.[ref][ref] The highest frequency of delta32 variants is found in the Faroe Islands (Denmark) with 2.3% of the population being homozygous for the mutation.[ref]

Here are some of the recent studies on the CCR5 Delta32 variant (rs333):

  • People who are homozygous for the variant (two copies of the variant) have a reduced chance of getting HIV when exposed. This isn’t complete protection for everyone, but it is a very significant reduction in the risk of HIV.[ref][ref][ref]
  • People who carry one copy of the variant (heterozygous) have a slower progression from HIV to AIDs and a reduced risk of mortality.[ref] [ref]
  • A preliminary (small) study found that carrying two copies of the Delta32 variant may make the hepatitis B vaccine less effective.[ref]
  • A small study shows that the Delta32 mutation may be protective against Crimean-Congo hemorrhagic fever.[ref]
  • Carriers of the Delta32 variant fare worse, though, with West Nile Virus.[ref]
  • Caucasian carriers of Delta32 may have a reduced risk of atherosclerosis.[ref] Asian carriers, though, may be at an increased risk for atherosclerosis.[ref]

CCR5 Delta32 variant:

Check your 23andMe results for  i3003626 (v4, v5) also known as rs333:

  • Insertion/Insertion  (either II or GTCAGTATCAATTCTGGAAGAATTTCCAGACA/GTCAGTATCAATTCTGGAAGAATTTCCAGACA): normal and not resistant to HIV
  • Insertion / Deletion (either DI or -/GTCAGTATCAATTCTGGAAGAATTTCCAGACA):  a slower progression from HIV to AIDs, reduced mortality risk from HIV
  • Deletion / Deletion (either DD or –): resistance to the common strains of HIV

Read more:

 

 

Categories: Disease Prevention

Leave a Reply

Your email address will not be published. Required fields are marked *

Related Posts

Disease Prevention

Factor V Leiden

Say you are chopping up peppers for your morning omelet and slip with the knife. Ouch! While cutting your finger seems to produce a huge amount of blood compared to the size of the wound, the Read more…

Disease Prevention

Will vitamin E increase or decrease your risk of cancer?

I often think that if a little bit of something is good for you, more should be even better…  But that is often not the case when it comes to health.  arge, population-wide studies of Read more…

Disease Prevention

Genetic Variants Associated with PCOS

Polycystic ovarian syndrome (PCOS) is an endocrine disorder that causes an increase in androgen hormone production in women. It affects 5 -10% of premenopausal women, and genetics plays a large role in whether you have PCOS. Read more…