Gingivitis and Your Genes

Have you ever gone to the dentist, expecting a good report, only to be fussed at by the hygienist for bleeding gums? You brushed, flossed, and stayed away from candy for the past six months — so why on earth do you still have inflamed gums?

Gingivitis:

Inflammation of the gums is known as gingivitis and caused by an inflammatory response in the tissue of your gums. Periodontal disease is another term you may have heard mentioned by your hygienist (as she stabs your gums with the sharp poking tool). Periodontal disease is a term that includes gingivitis and then the next step – inflammation of the jaw bone and loose teeth.[ref]

So what causes gingivitis? Lack of brushing and flossing…  maybe. Smoking, for sure.

But what if you do regularly brush and floss? And what about those people (you know who you are) who don’t brush and floss but have healthy gums?

Notably, the key here is the body’s response to the bacteria and biofilm on the teeth. The mouth is teeming with bacteria, and your immune system is on high alert to keep those bacteria from crossing into the bloodstream.

This isn’t just about a little bleeding when you brush or floss. Gingivitis and the increased risk of heart disease are also connected. This connection may be due to increased systemic inflammation.[ref]

Frequently, people with gingivitis have higher CRP levels on average than people without gingivitis. And people with periodontitis had even higher CRP levels.[ref]


Genetic variants associated with gingivitis

Log in to see your data below Not a member? Join now.

TNF-α (Tumor necrosis factor-alpha) gene:
TNF-α is an inflammatory cytokine involved in the body’s immune response. TNF is important to have in the right amounts.  It helps the body destroy cells with aberrant DNA, but too much TNF is implicated in inflammatory diseases such as rheumatoid arthritis.  TNF-α is stimulated by bacterial endotoxin (lipopolysaccharide) as well as other pathogens.  It is one of the body’s primary mediators in protection against bacteria and viruses.  Chronically elevated levels of TNF have implications for a variety of autoimmune diseases.

Check your genetic data for rs1800629 (23andMe v4, v5; AncestryDNA):

  • A/A: 2 to 3-fold increase in TNF-α; increased risk of periodontitis[ref]
  • A/G: increased TNF-α; increased risk of periodontitis
  • G/G: typical

Members: Your genotype for rs1800629 is .

IL1A gene (Interleukin 1) and IL1B gene:
Interleukin 1 is another inflammatory cytokine produced by lymphocytes or monocytes and released in response to endotoxins.

Check your genetic data for rs1800587 (23andMe v4, v5; AncestryDNA):

  • A/A: increased IL1A[ref]; increased risk of gingival bacterial colonization[ref] increased risk of periodontitis[ref]
  • A/G: increased risk of gingival bacterial colonization
  • G/G: typical

Members: Your genotype for rs1800587 is .

Check your genetic data for rs1143634 (23andMe v4, v5; AncestryDNA):

  • A/A: increased risk of gingivitis[ref][ref][ref]
  • A/G: increased risk of gingivitis
  • G/G: typical

Members: Your genotype for rs1143634 is .

IL-6 gene:
Interleukin 6 acts both as inflammatory cytokine and as an anti-inflammatory signal by moderating TNF-alpha. This is another important cytokine in infection but can also become a problem if it is not regulated well by the body.[read more]

Check your genetic data for rs1800795 (23andMe v4, v5; AncestryDNA):

  • G/G:  typical risk of gingivitis
  • C/G: typical risk of gingivitis
  • C/C: higher risk of gingivitis and periodontitis[ref][ref]

Members: Your genotype for rs1800795 is .

IL8 gene:
Interleukin 8 is an important regulator of inflammatory response.

Check your genetic data for rs4073 (23andMe v4, v5; AncestryDNA):

  • A/A: increased IL8, somewhat increased risk of periodontitis[ref]
  • A/T: probably normal risk of periodontitis[ref]
  • T/T: typical

Members: Your genotype for rs4073 is .

IL10 gene:
The IL10 gene codes for the IL-10 (interleukin-10) anti-inflammatory cytokine. Variants causing a decrease in the amount of IL10 are associated with increased inflammation. In contrast, variants that cause an increase in IL10 are associated with less inflammation.

Check your genetic data for rs1800896 (23andMe v4, v5; AncestryDNA):

  • T/T: Common genotype, more likely to have gum disease
  • C/T:  more likely to have gum disease
  • C/C: higher IL-10, less likely to have gum disease[ref]

Members: Your genotype for rs1800896 is .

CCR5 gene:
The CCR5Δ32 variant is also linked with reduced mortality risk from HIV for people with one copy. Carriers of two copies of the mutation are resistant to common strains of HIV.

Check your genetic data for rs333 (23andMe – i3003626 v4,v5):

  • Insertion/Insertion  (either II or GTCAGTATCAATTCTGGAAGAATTTCCAGACA/ GTCAGTATCAATTCTGGAAGAATTTCCAGACA): typical
  • Insertion / Deletion (either DI or -/GTCAGTATCAATTCTGGAAGAATTTCCAGACA): decreased risk of periodontitis.
  • Deletion / Deletion (either DD or -/-): decreased risk of periodontitis.[ref]

Members: Your genotype for i3003626 is .

 


Lifehacks for reducing gingivitis:

Natual Options:

Here are some natural options to explore for reducing inflammation in your gums:

It almost goes without saying (but I’m saying it anyway) that good oral hygiene measures such as brushing your teeth are always important.

Natural TNF inhibitors include quercetin, resveratrol, and turmeric (curcumin). Studies show that resveratrol and curcumin specifically reduce the progression of periodontitis.[ref][ref]  You can get resveratrol as a supplement online or at your local health food store.  You can also get curcumin as a supplement or through incorporating the spice turmeric into your diet.

Glycine, found in bone broth, has shown to inhibit TNF-α due to endotoxins in a study.[ref]

Green tea: Swish with some green tea? A study found that using green tea as a mouthwash worked better for reducing gingivitis than chlorhexidine gluconate (germicidal mouthwash).[ref]

Reducing fluoride: Studies show fluoride increased inflammatory cytokines including TNF-α, IL-1β, and IL-6.[ref][ref] [ref] Does this mean that you should stop drinking fluoridated water and use toothpaste without fluoride? I don’t know. I’ll let you read through the research and decide for yourself.

Vitamin C: Getting enough vitamin C in your diet is important for gum and tooth health. One of the first symptoms of scurvy includes swollen gums and loose teeth. But what about in our modern era when scurvy is practically non-existent? It turns out, a low intake of vitamin C has shown to increase the risk of periodontitis in several studies.[ref][ref][ref]  Foods rich in vitamin C include sweet peppers, citrus fruits, peaches, and broccoli. Not into fruits and vegetables? A bag of Skittles gives you 69% of the RDA for vitamin C. (Skittles are definitely not recommended for dental health, even though they have vitamin C :-)[ref]

Saltwater: Rinsing with saltwater actually may help with gingivitis. In fact, saline rinses have been used (in China) since 2700 BC. The study on saline shows that it increased type-I collagen and fibronectin in gingivitis cells.[ref]


Related Genes and Topics:

 

Should you increase your vitamin C intake? Genetics and vitamin C absorption
Like most nutrients, our genes play a role in how vitamin C is absorbed, transported, and used by the body.  This can influence your risk for certain diseases, and it can make a difference in the minimum amount of vitamin C you need to consume each day.

TNF-alpha: Inflammation and Your Genes
Do you feel like you are always dealing with inflammation? Joint pain, food sensitivity, etc? Perhaps your body genetically gears towards a higher inflammatory response. Tumor necrosis factor (TNF) is an inflammatory cytokine that acts as a signaling molecule in our immune system. In an acute inflammatory situation, TNF-alpha plays an essential role in protecting us.

 



Author Information:   Debbie Moon
Debbie Moon is the founder of Genetic Lifehacks. She holds a Master of Science in Biological Sciences from Clemson University and an undergraduate degree in engineering. Debbie is a science communicator who is passionate about explaining evidence-based health information. Her goal with Genetic Lifehacks is to bridge the gap between the research hidden in scientific journals and everyone's ability to use that information. To contact Debbie, visit the contact page.