Glyphosate: Interaction with Genetics

RoundUp is the most widely used herbicide in the world. It is made by Monsanto, which is now owned by Bayer. Glyphosate is the active ingredient in RoundUp, and it will kill most broadleaf plants and grasses. [ref]

Glyphosate works by blocking the shikimate pathway, which is a vital enzyme pathway in plants and some microorganisms. The shikimate pathway is the process by which plants, bacteria, archaea, fungi, and algae make folates and certain amino acids (tryptophan, tyrosine, and phenylalanine). Without those amino acids, the plants and microorganisms die.

The shikimate pathway isn’t found in animals, and the amino acids that it makes are ones that we must get from our diet (essential amino acids for humans). Thus, RoundUp doesn’t kill us outright like it does plants.

Why is RoundUp the most popular kid on the herbicide block? The creation of RoundUp Ready genetically modified crops has increased the use of RoundUp by 100-fold since the 1970s. These RoundUp Ready crops can be sprayed with glyphosate and not die. Thus, farmers can spray their RoundUp Ready soybean field, killing all the weeds and leaving their crop standing tall.

The EPA says that ‘there are no risks to public health why glyphosate is used in accordance with its current label and that glyphosate is not a carcinogen’.[ref]

On the other hand, the International Agency for Research on Cancer (IARC) lists glyphosate as a ‘probable carcinogen’ and several recent lawsuits have successfully shown the link between glyphosate and non-Hodgkin’s lymphoma. [ref]

Genetic variant impacted by glyphosate:

A study came out a couple of weeks ago showing that some people are more affected by glyphosate than others. [ref]

The study found that people with CYP1A1 genetic variants are more likely to have problems with acetylcholinesterase inhibition from glyphosate.

Glyphosate has been shown in animal studies to affect acetylcholinesterase a little bit.  Acetylcholinesterase is the enzyme that breaks down acetylcholine, which is an important neurotransmitter. Acetylcholine transfers the signal between the nerves that control your muscles (and also neurons in the brain). Think of it as the on switch for a muscle nerve which causes a contraction. For every ‘on’ impulse, you need to stop the signal with an ‘off switch’ — that would be acetylcholinesterase.

The animal studies show that glyphosate inhibits acetylcholinesterase (a little).[ref][ref] If you totally inhibit acetylcholinesterase, it can lead to paralysis, convulsions, and death due to asphyxiation (i.e. not being able to move the muscles around the lungs to breath). This is how nerve gas, such as Sarin gas, works in chemical warfare. Not pretty… but, also nothing like the very low levels that we are talking about here.

Serum cholinesterase can also be used as a marker of herbicide poisoning because it is decreased when liver function is damaged.[ref]

Getting back to glyphosate and how it affects people…

The recent study[ref] was done on people whose job it was to make glyphosate (in China). Those people were exposed to only to glyphosate (no other pesticides), and their blood was tested to see what their serum acetylcholinesterase levels were. These pesticide manufacturers were exposed to glyphosate through their work. (Experiments cannot be done on humans by making them consume glyphosate – that would not be cool. Instead, researchers look at people that have already been exposed to higher than normal levels.)

The study showed that people with the CYP1A1 rs1048943 A/G or G/G genotype were more likely to have lower acetylcholinesterase levels due to glyphosate exposure. This variant alters CYP1A1 expression.  Lower acetylcholinesterase was assumed to be a marker of liver damage.

Check your genetic data for rs1048943 (23andMe v4 only):

  • T/T: normal
  • C/T: more likely to have low acetylcholinesterase due to glyphosate exposure, especially in women
  • C/C: more likely to have low acetylcholinesterase due to glyphosate exposure, especially in women[ref]

 

A couple of take-aways from this study:

First, there is an effect from glyphosate on acetylcholinesterase levels, especially at higher exposure levels. This isn’t necessarily a big problem for most people, but it is interesting. Most of the  EPA information says that glyphosate passes through people without being metabolized — which apparently isn’t completely accurate.

Second, the urinary glyphosate metabolite levels of these Chinese glyphosate manufacturer workers were not extraordinarily high. A recent study of children in Mexico showed similar average concentrations to that of the Chinese workers. [ref]

Third, why on earth are there not more genetic related studies on glyphosate? It is something that almost all of us are exposed to on a regular basis.

 

 

 

TNF-alpha: Inflammation Genes

genetic variants 23andme TNF alpha

Do you feel like you are always dealing with inflammation? Joint pain, food sensitivity, etc? Perhaps you are genetically geared towards a higher inflammatory response. Tumor necrosis factor (TNF) is an inflammatory cytokine that acts as a signaling molecule in our immune system. In an acute inflammatory situation, TNF-alpha plays an essential role in protecting us.

What is Tumor Necrosis Factor- Alpha?

TNF-alpha is an inflammatory cytokine that is produced by the immune system cells (macrophages) during acute inflammation. Its main role is to signal that the cell needs to be destroyed (apoptosis).[ref]

We think of redness, swelling, heat, and pain with inflammation such as after getting a cut or wound. The inflammatory response is also important for fighting off bad bacteria, viruses, or fungus.  Cytokines, such as TNF-alpha (and others), are released when an inflammatory response is needed to fight off an invader.

When TNF-alpha binds to its receptor on the surface of a cell, one option is that kills the cell. Kind of like it pulls the pin on a grenade. Another option is that it can also cause the cell to produce other inflammatory response molecules, but the cell still survives.

While cell death sounds bad, it is completely necessary to fight off certain infections or if a cell is cancerous.

In fact, some of the genetic variants that increase TNF-alpha levels are linked to being better able to fight off pathogens, such as malaria.

But that superpower of fighting infection comes with a price.  Chronically elevated levels of TNF-alpha are linked with a lot of autoimmune diseases. The same genetic variant that helped your ancestors survive an infection (and thus live to pass on the variant to you), may be at the root of many of the inflammatory conditions that plague us today. [ref]

Higher TNF-alpha is linked to:

  • rheumatoid arthritis
  • psoriasis
  • ulcerative colitis
  • Crohn’s disease
  • skin infections
  • gum disease
  • asthma
  • diabetic ulcers
  • heart disease
  • septic shock
  • depression

TNF Gene Variants:

There are several genetic variants linked to naturally more active TNF-alpha.

Check your genetic data for rs1800629 (23andMe v4, v5; AncestryDNA):

  • A/A: higher TNF-alpha levels, more inflammation – see risks below
  • A/G: higher TNF-alpha levels – see risks below
  • G/G: normal, better response to high protein/low carb diet

Studies on rs1800629 (also known as -308) show:

 

Check your genetic data for rs361525 (23andMe v4, v5; AncestryDNA):

    • A/A: higher TNF-alpha levels[ref], increased risk of psoriasis[ref], asthma[ref], COPD[ref]
    • A/G: somewhat higher TNF-alpha levels
    • G/G: normal

 

Check your genetic data for rs1799964 -1031  (23andMe v4, v5; AncestryDNA):

  • C/C: (usually) higher TNF-alpha levels[ref][ref], increased risk of IBD[ref], lupus[ref], gum disease[ref]
  • C/T: somewhat higher TNF-alpha levels
  • T/T: normal – generally not at higher risk for inflammatory diseases

 

Check your genetic data for rs1799724 (23andMe v4, v5):

  • T/T: (generally) higher TNF-alpha levels[ref][ref]
  • C/T: (generally) higher TNF-alpha levels
  • C/C: normal – generally not at higher risk for inflammatory diseases

 


Lifehacks:

Rosmarinic acid (found in rosemary, basil, holy basil, lemon balm, and perilla oil) is a natural TNF-alpha inhibitor[ref]. In addition to adding herbs to your food, holy basil can be found in a tea (called Tulsi tea) or supplement. Examine.com has good information on rosmarinic acid.

Curcumin is another natural TNF-alpha inhibitor[ref].  Turmeric is a spice that is a good source of curcumin in the diet; curcumin supplements are also available and may be easier to take on a daily basis

Probiotics containing Bifidobacteria or Lactobacillus may decrease TNF-alpha levels. [ref] One study showed that B. adolescentis decreased TNF-alpha levels and had an antidepressant effect. [ref] In kids with celiac disease, Bifidobacterium breve BR03 decreased TNF-alpha levels. [ref] Lactobacillus Plantarum has been shown to restore tight junctions (decrease leaky gut) in the intestines. It is also decreased TNF-alpha. [ref]

Aged garlic extract was shown in a study to decrease TNF-alpha levels by 35% [ref] [ref]. You can find aged black garlic at grocery stores, and it is available as a supplement on Amazon if you don’t like the taste of aged garlic.

Glycine has been shown to reduce TNF-alpha and inflammation[ref]. Glycine is an amino acid that is abundant in bone broth, collagen, and gelatin. My favorite way to increase my intake of gelatin is to dissolve it in my coffee each morning.  Here is one that I use:  Zint Beef Gelatin.  Or you could try a hydrolyzed collagen that dissolves in hot or cold liquids.

Low magnesium levels may play a role in higher TNF-alpha levels. Magnesium sulfate, in conjunction with thyroid medication, in hypothyroid rats, decreased TNF-alpha levels.[ref][ref]

Estrogen: How it is made and how we get rid of it

genetics and estrogen metabolism

Estrogen is usually thought of as the female hormone. While it is true that women produce more estrogen than men, this is a topic that applies to all of us. Estrogen – from how much is made to how it is broken down – is dependent on both genetics and lifestyle factors and affects both men and women.

If you’re like me, you probably think “I know what estrogen is”, but do you? really? I’ll be honest and admit that I hadn’t really thought about how estrogen works within a cell and what exactly it is doing.

This article explains (from a genetic point of view):

  • how estrogen is made
  • how that estrogen is broken down – and –
  • how this influences the risk of breast cancer, prostate cancer, and uterine fibroids

Disclaimer: Everything written here is for informational purposes. Talk with your doc, read through the referenced literature before making any decisions – especially in relation to cancer or cancer prevention. 

Estrogen creation and metabolism

When you look up estrogen online, it is usually defined as ‘a female sex hormone’… which really tells you nothing. There are actually several different types of estrogen, and it is a hormone important in both males and females.

Types of estrogen:

There are several forms of estrogen in the body, and the amounts of each type become important for hormone-related cancer risk and uterine fibroids. [ref]

  • Estradiol (E2) or 17β-Estradiol – primary form in women prior to menopause
  • Estriol (E3) – main type of estrogen during pregnancy
  • Estrone (E1)  -primarily made after menopause
  • Estretrol (E4) – only during pregnancy, made by the fetus

How is estrogen made?

Estrogen is made in the ovaries (major source, women), testes (males), brain, liver, pancreas, fat cells, intestines, and adrenals. [ref] The precursor for estrogen is cholesterol.

Cholesterol is first converted (using CYP11A1) into progesterone, which is then converted (using CYP17A1) into androstenedione.

Androstenedione can be converted into testosterone, dihydrotestosterone, or estrogen.

If it goes the estrogen route, androstenedione is converted (using CYP19A1) first to estrone, which is then converted (using 17β-HSD) into estradiol. [ref]

This definitely needs a flow chart!

how estrogen is made from cholesterol

Within follicle cells in the ovary, the conversion of the steroid hormone precursor into estrogen is controlled by follicle stimulating hormone (FSH) levels. FSH is produced in the pituitary gland, and, along with luteinizing hormone, controls the menstrual cycle.

Estrogen Sulfate:

If you ever get a hormone panel done, you will probably see estrogen sulfate listed. Estrogen sulfate is the most abundant form of estrogen, but it is also not very active.  It can be considered as a storage form of estrogen that can be converted by HSD17B1 (17β-Hydroxysteroid dehydrogenase) into estradiol.  High levels of estrogen sulfate can be a risk factor for breast cancer.

What does estrogen do in the body?

Estrogen regulates the menstrual cycle and is imperative for reproduction. The ‘primary and secondary sexual characteristics’ of women (breasts, wider hips, lack of facial hair, etc) are due to estrogen.

For everyone, estrogen is also important in maintaining bone density. Low estrogen is linked to osteoporosis. It is also important in brain function and controlling inflammation. 

In men, estrogen is also necessary (at low levels) in the production of sperm. Loss of the estrogen receptor in the testes results in abnormal sperm. On the other hand, too much estrogen can also be bad. [ref][ref]

What happens when you have too much estrogen?

Signs of excess estrogen in women include:

  • weight gain
  • heavy periods
  • fibroids
  • PMS
  • fibrocystic breasts
  • loss of sex drive
  • fatigue, depression, anxiety

For men, too much estrogen leads to:

  • gynecomastia (a.k.a. man boobs)
  • sexual dysfunction
  • loss of muscle mass
  • fatigue, depression, anxiety

Digging deeper – estrogen receptors:

So we know that estrogen does a lot in the body – but exactly how does this work? Estrogen is transported all over the body via the bloodstream and then enters into cells.

So what exactly does estrogen do in cells?  It binds to estrogen receptors in the nucleus causing them to turn on and off the transcription of a number of different genes. Thus, the different estrogen receptors can control whether a gene gets transcribed into a protein that is used in the cell.

There are several different estrogen receptors:

  • ERα is encoded by the gene ESR1 gene.
  • ERβ is encoded by the ESR2 gene.
  • G protein-coupled estrogen receptor 1 is encoded by the GPER1 gene.

The estrogen receptors can bind to and turn on hundreds of different genes. Some that are important include the LDL receptor, progesterone receptor, IGF-1, and many more. These genes are related to hormones, cholesterol, and growth within the body.[ref]

In a nutshell, estrogen causes the body to increase the production of other hormones, growth factors, and metabolic factors. 

Getting rid of estrogen (metabolism):

To control the level of estrogen in the body, we have to have a way to break it down and eliminate it. This is a multi-step process.

In the liver, the CYP450 enzymes can metabolize estrogen. Specifically, this is done by the CYP1B1, CYP1A1, or CYP1A2 enzyme.  This process creates metabolites known as 2-OHE1 (E2), 4-OHE1(E2), and 16α-OHE1, all of which are also known as catechol estrogens.

These catechol estrogens can be metabolized by COMT (catechol-O-methyltransferase) or through glucuronidation (UGT genes) This makes them water-soluble and able to be excreted. [ref]

Essentially, this is a two-step process that needs to work in tandem:

  • Phase I, the CYP1B1 or CYP1A1 breaks down estradiol into the catechol estrogen metabolites.
  • Phase II, they need to be made into water-soluble substances (by COMT, UGTs).

Why is it so important that both phases happen in sync? Because some of the metabolites, such as 16α-OHE1, are also able to activate the estrogen receptors — and are implicated, big time, in breast cancer.[ref] So you don’t want certain Phase I metabolite hanging around in the body.

To recap: estrogen is broken down in two phases. The different phase I options can cause ‘good’ or ‘bad’ metabolites. Phase II then needs to make those metabolites water-soluble, so that they can be pooped or peed out.

Estrogen metabolites linked to breast, ovarian, and prostate cancer:

For breast cancer, the 4-OHE1(E2) and 16α-OHE1 metabolites are implicated in increasing the risk. Higher amounts of 2-OHE1(E2) or a better ratio of 2-OHE1:4-OHE1 decreases breast cancer risk. Additionally, you don’t want too much estrogen (E1 or E2), in general, hanging around (Goldilocks here- just the right amount is needed).  [ref][ref]

Prostate cancer risk is increased with 4-HOE1(E2) metabolites also. [ref]

In general – the estrogen metabolites that start with “2” are good and the ones that start with “4” or “16” need to be limited.  But this, in part, depends on your phase II metabolism as well.

So let’s take a look at how these catechol estrogen metabolites are formed and then processed out of the body with a nifty diagram:

As you can see, upregulating the CYP1A1 enzyme is going to increase the 2-OHE1 path.

Too much estrogen being metabolized through CYP1B1 into 4-OHE1(E2) and the estrogen quinones can potentially be bad if your body has slower phase II  (COMT, GSTP1, GSTM1, NQO1) enzymes. [ref][ref]

The connection between smoking and estrogen-related cancers:

Smoking increases the risk of breast cancer and prostate cancer. I had always assumed that this is simply because smoking is bad… and I had never thought about why those specific cancers would be connected to smoking.  Part of the ‘why’ is because cigarette smoke causes DNA damage – it’s bad :-).

But the specific of ‘why breast cancer‘ is that components of cigarette smoke increase the CYP1B1 and CYP1A1 enzymes. If that increase is tipped towards the CYP1B1 path (due to genetic variants) and you can’t get rid of the estrogen metabolites fast enough (due to phase II genes, diet, lifestyle), then cigarette smoking is going to increase the ‘bad’ estrogen metabolites. Smoking also may impair the phase II metabolites, thus creating more estrogen quinone metabolites with a decreased ability to eliminate them. [ref][ref]

Therefore, combining some of the phase I and phase II genetic variants (below) with smoking causes a fairly large increase in the risk of cervical, breast, or prostate cancer.

Estrogen Elimination:

Let’s go one step further and make the two-step process of estrogen metabolism into a three-step process…  because once the catechol estrogen metabolites have been metabolized (COMT), they have to be excreted (yep – urine or feces).  And this becomes important as well when it comes to the gut microbiome…

The estrogen that has been metabolized and is ready to be eliminated through feces can actually be recycled back into circulation due to an interaction with certain bacteria in your gut microbiome. Beta-glucuronidase, produced by the gut microbiome, can reverse the reaction that the UGT enzymes did to make the estrogen metabolites more water-soluble. This can cause the estrogen metabolites to be reabsorbed from the intestines and go back into circulation.[ref]

Calcium d-glucarate can suppress the beta-glucuronidase activity in the gut, thus increasing the amount of estrogen metabolites that are excreted (which is a good thing!).[ref]

Estrogen Mimics:

There are several environmental toxicants that act similarly to estrogen in the body.  Among these, phthalates and BPA are ubiquitous and found in almost everyone’s body these days. These chemicals can bind to the estrogen receptors. [ref][ref]

Phthalates are used in vinyl, plastics, adhesives, artificial fragrances (laundry detergent, air freshener), personal care products, and more.  [ref]

BPA is also found in plastics and we are exposed through food and drinks being stored in plastic containers or cans with linings that contain BPA. Even the paperboard used in food packaging (especially if it is recycled cardboard) can contain BPA which is transferred to food.[ref]

These estrogen mimics (at the levels found in people every day) have been linked to increased risk of:

  • endometriosis [ref]
  • enlarged prostate [ref]
  • almost 2-fold increase in breast cancer for higher phthalate exposure (estrogen receptor-positive) [ref]
  • BPA exposure at low levels is linked to increased breast and prostate cancer[ref]
  • uterine fibroids[ref][ref]

 


Genetic variants:

I’ve thrown a lot of terms and gene names at you.  Let’s get specific in how this applies to you and your genetic variants.

Most of these are really common genetic variants, so don’t freak out if you have one or all of the variants and they are linked to cancer. Lots of things are linked to cancer… The variants interact with each other as well as with your diet and lifestyle when it comes to various conditions associated with them. The point here is to use the information to make changes – dietary, lifestyle – to minimize your risk factors.

Here is the nifty diagram again so that you don’t have to scroll back up:

Estrogen metabolism genes:

Phase 1 metabolism:

CYP1A1 gene:
phase I detoxification of estrogen into 2-OHE1(E2)

Check your genetic data for rs1048943 (23andMe v4 only):

  • T/T: most common type, normal function
  • C/T: increased risk of cervical cancer; increased risk of fibroids
  • C/C: increased risk of cervical cancer[ref], especially in smokers (8-10-fold increase in risk for active smokers)[ref] increased risk of uterine fibroids [ref][ref]

CYP1B1 gene:
phase I detoxification of estrogen into 4-OHE1(E2)

Check your genetic data for rs1056836 Leu432Val (23andMe v4, v5; AncestryDNA):*

  • G/G: (Leu/Leu – slower); decreased estradiol metabolism [ref] increased hot flashes, especially in smokers [ref]
  • C/G: intermediate/decreased estradiol metabolism [ref]
  • C/C: (Val/Val – faster); decreased risk of prostate cancer [ref][ref]

*Note that these are referred to in the plus orientation to match 23andMe data. This variant is prone to confusion because the variant is very common and the orientation is often switched in studies.

Check your genetic data for rs1056827 A119S (23andMe v4 only):

  • C/C: normal
  • A/C: somewhat increased risk of uterine fibroids
  • A/A: increased risk of breast cancer [ref] increased risk of uterine fibroids [ref]

CYP3A4 gene:
converts estrogen into 16a-OHE1 (higher levels linked to breast cancer)

Check your genetic data for rs2740574 (23andMe v4, v5; AncestryDNA):

  • T/T: normal
  • C/T: somewhat increased risk of ovarian cancer
  • C/C: increased risk of ovarian cancer, prostate cancer [ref]; increased CYP3A4 activity [ref]

Phase II estrogen metabolism genes:

COMT gene:
phase II detoxification of estrogen metabolites

Check your genetic data for rs4680 (23andMe v.4 and v.5):

  • G/G: (Val/Val) higher COMT activity
  • A/G: intermediate COMT activity
  • A/A: (Met/Met) lower COMT activity; increased risk of hot flashes, especially in smokers[ref] increased risk of breast cancer [ref]

GSTP1 gene:
another phase II detoxification enzyme important for reducing estrogen quinones

Check your genetic data for rs1695 (23andMe v4, v5; AncestryDNA):

  • A/A: normal
  • A/G: normal risk of breast cancer
  • G/G: reduced function, increased risk of breast cancer [ref] increased risk of prostate cancer[ref]

GSTM1 gene: another phase II detoxification enzyme important for reducing estrogen quinones

Check your genetic data for rs366631 (23andMe v4 only):

  • A/A: deletion (null) GSTM1 gene. GSTM1 deletion is associated with 2x increased risk of breast cancer [ref]  This is actually the most common genotype in most populations.
  • A/G: GSTM1 present
  • G/G: GSTM1 present

UGT1A1/6 gene:
phase II detoxification gene for reducing estrogen metabolites

Check your genetic data for rs2070959 (23andMe v4, v5; AncestryDNA):

  • A/A: normal
  • A/G: normal
  • G/G:  lower enzyme activity [ref] possibly increased breast cancer risk[ref]

NQO1 gene: phase II detoxification enzyme

Check your genetic data for rs1800566 (23andMe v4, v5; AncestryDNA):

  • A/A: slightly increased cancer risk [ref] [ref] very low NQO1 enzyme activity [ref]
  • A/G: slightly increased cancer risk, reduced NQO1 enzyme activity
  • G/G: normal

While each of these genetic variants individually increases the risk of estrogen-related cancer by a bit, the combo of variants and the interaction with lifestyle factors can be large. Faster phase I metabolism combined with slower phase II metabolism can be a problem.[ref]

A combo of CYP1B1 rs1056836 CC (Val/Val – faster) and COMT rs4680 AA (Met/Met – slower) increases the risk of ovarian cancer significantly (2 – 5-fold). Smoking interacts here to also dramatically increase the risk of ovarian cancer in these women. [ref][ref]

The combo of CYP1B1 rs1056836 CC and COMT rs4680 AA also increases (somewhat) the risk of prostate cancer. [ref] This combo also doubles the risk of breast cancer.[ref]

Other studies simply note that a number of combos of the higher risk alleles in all these genes increase the risk of breast cancer.[ref]

Genes involved in making estrogen:

Here is the estrogen creation diagram again:

how estrogen is made from cholesterol

CYP19A1 gene (aromatase): converts androstenedione and testosterone into estrogen

Check your genetic data for rs4646 (23andMe v4, v5; AncestryDNA):

  • A/A: less common genotype, lower estrogen levels;  longer breast cancer survival in premenopausal women but shorter survival in postmenopausal women [ref]
  • A/C: intermediate
  • C/C: most common genotype, higher estrogen levels [ref]

Check your genetic data for rs700518 (23andMe v4, v5; AncestryDNA):

  • T/T: increased risk of benign prostate hyperplasia[ref]; higher estrogen levels (men)[ref]
  • C/T: intermediate
  • C/C: lower estrogen levels (men)

CYP17A1 gene: converts progesterone into androstenedione

Check your genetic data for rs743572 (23andMe v4 only; AncestryDNA):

  • A/A: normal
  • A/G: decreased risk of breast cancer
  • G/G: decreased risk of breast cancer [ref]

 


Lifehacks:

Most of these life hacks are geared towards getting rid of excess estrogen. Keep in mind that you may not want to get rid of estrogen, depending on your age and estrogen levels. There is no one size fits all here!

Testing is the only way to actually know your estrogen levels. You can order your own hormone test panels online (UltaLabs Estrogen Panel) or go to a doctor. Honestly, this is one area that even if you don’t like to go to the doctor, you may want to find a qualified person to help with interpreting the test results.

Phase I enzymes:

CYP1A1:
Diindolylmethane (DIM) is a compound found in cruciferous vegetables. DIM upregulates CYP1A1.[ref] For someone who has a slower CYP1A1 variant or a faster CYP1B1 variant, this may be a really good thing.  DIM may also decrease CYP19A1 (aromatase), thus decreasing the production of estrogen, to begin with.

You could eat a ton of cruciferous vegetables to get your DIM, or it is available as a supplement. Cabbage is the cruciferous vegetable highest in DIM.

Studies show that DIM increases the ratio of 2-OHE1:16α-OHE1 — which may be beneficial for preventing cancer.[ref][ref] There is some good evidence that it may be beneficial for prostate cancer as well[ref][ref], but not all studies agree [ref]. Read the studies, talk with your doctor.

If you decide to supplement with DIM, a lot of clinicians recommend combining it with calcium d-glucarate (which helps with estrogen elimination). Jarrow sells a combo of DIM and calcium d-glucarate, or you can get them as separate supplements if you want to take them at different times of the day.

One more layer to add into the complexity here:  Circadian Rhythm.
The CYP1A1 enzyme levels rise and fall over the course of a day along with the core circadian gene, CLOCK. [ref] If I understand the research correctly, taking DIM in the morning may be more effective than taking DIM at night.

CYP3A4:
CYP3A4 is the enzyme needed for converting estradiol into 16α-OHE1.

Grapefruit juice and bergamot (both contain bergamottin) inhibit CYP3A4. You may think (like I did) that inhibiting the production of 16α-OHE1 would decrease breast cancer risk. On the other hand, inhibiting CYP3A4 may also increase the overall amount of estrogen in the body.  Studies on grapefruit show mixed results:  Drinking grapefruit juice has been shown to lower estradiol in postmenopausal women.[ref] One study did find that eating grapefruit increased the risk of breast cancer a little bit.[ref] Another study found no effect from eating grapefruit.[ref] None of the studies looked at the ratio of 2-OHE1:16α-OHE1…

Just make sure that you don’t drink grapefruit juice while taking a medication that needs the CYP3A4 enzyme! The effects of a 6 oz glass of grapefruit juice can last for 24 hours.[ref]

St. John’s wort increases CYP3A4.[ref][ref]  I can’t find any research studies, though, that show that this could increase breast or prostate cancer risk. It may have benefits, such as inhibiting CYP1B1, that outweigh any possible negatives from the increase in CYP3A4.[ref]

Increasing Phase II enzymes:

You want to avoid 4-OHE1/2 hanging around, and if you have a slow COMT gene, the 4-OHE1 can be turned into quinones, which are bad… To get rid of the quinones, you need the phase II enzymes, GST’s or NQO1, both of which are controlled by Nrf2 and increased by cruciferous vegetable intake.

Sulforaphane and/or cruciferous vegetable intake increase GST and NQO1. You can get sulforaphane from eating broccoli sprouts or via a supplement.  Cruciferous vegetables are available in your grocery store :-) Cruciferous veggies include cabbage, broccoli, cauliflower, kale, collards,  and Brussels sprouts.

One study specifically found that women with the GSTP1 rs1695 G/G genotype overall were at a slightly greater risk of breast cancer — but that was because cancer risk increased quite a bit when the women had a low cruciferous vegetable intake. [ref] Thus, eat your cruciferous veggies.

N-acetyl cysteine (NAC) and resveratrol have been shown to reduce the catechol estrogen quinones (bad stuff).  [ref]  These work by increasing the expression of NQO1,  which reduces the quinones to catechols [refNAC and resveratrol are both available as supplements on Amazon and at your local health food store.  (Note that if you carry the NQO1 rs1800566 TT genotype which has very low enzyme activity, this may not be as effective for you.)

Getting rid of estrogen mimics:

Both phthalates and BPA are thought to mimic estrogen in the body and have been shown to bind to the estrogen receptors.

The question of how to get rid of these ubiquitous chemicals, though, is a tough one… most studies find that 90 – 100% of people have them in their body on any given day.

Personal care products that contain phthalates have been shown to significantly increase phthalate levels in the body.  Go read the labels and see what you are using each day (shampoo, body wash, lotions, etc). Look for the big long chemical words that contain ‘phthalate’ in there somewhere. For example, dibutyl phthalate or di-2-ethylhexyl phthalate.

Perfumes and fragrances often contain phthalates.[ref] Cosmetics and perfume sales clerks were found to have higher phthalate levels after their shift at work. [ref] Synthetic air fresheners and laundry detergent fragrances can be another source.[ref]

A new study just came out this month showing that skin exposure to phthalates from clothing is actually the largest source for babies (Chinese study). [ref] Other studies, though, point to inhaling phthalates through dust particles.[ref]  This would be a good reason to go dust and vacuum your house today.

BPA is found in plastics (don’t microwave your food in plastic) and plastic water bottles. Most people know this…  get a glass water bottle and some glass containers for storing your leftovers.

Canned foods have high levels of BPA due to the can linings containing PVC.[ref] So switching to eating fresh vegetables should help decrease BPA exposure somewhat. (A recent study of people in NC found that BPA in food only explained about 20% of the daily dose, but older studies show it being more significant.[ref])

But what a lot of people don’t realize is that BPA or BPS is also used on thermal cash register receipts.[ref][ref] One study found that using hand sanitizer and then holding a cash register receipt for a couple of minutes increased BPA levels considerably. This was done with people holding a cash register receipt after using hand sanitizer and then eating french fries. (This is such a real-world scenario for any germaphobe stopping for a fast-food lunch.) Wet hands were found to have a 100-fold increase in BPA transfer from the thermal printed receipt paper.  There was also a huge increase in serum BPA (both transdermal and transfer to the french fries, although they only ate 10 french fries…).

More to read:

 

Sore muscles after workouts? Could be AMPD1 deficiency.

Do you end up getting sore after pretty much every work out at the gym? It could be that a deficiency caused by the AMPD1 genetic variant is the cause. (Or you could be over-doing it :-)

Adenosine Monophosphate deaminase is an enzyme coded for by the gene AMPD1, which acts in the skeletal muscles to convert AMP to IMP.  In a nutshell, this is an enzyme that your muscles use when they need to make a lot of ATP for energy.

There is one common AMPD1 genetic variant, known as C34T, that causes a decrease in the function of this enzyme. Caucasian and African populations carry one copy of the variant at a frequency of about 10%. It is much less frequent in other population groups.

AMPD1 deficiency, also known as myoadenylate deaminase deficiency, has varying effects on exercise performance, heart attack response, and methotrexate (cancer drug) response. It causes sore muscles and possibly muscle spasms when working out. But it also may be protective against heart disease. [ref]

Does AMPD1 deficiency mean that you can’t work out? Absolutely not. It just means that you may have more pain or muscle soreness than other people do. It’s just genetic – and doesn’t mean that you are a workout wuss!


AMPD1 Genetic Variant:

Check your genetic data for rs17602729 (23andMe v4, v5; AncestryDNA):

  • AA: loss of function variation for AMP Deaminase (increased adenosine formation, muscle soreness in exercise, various other effects),[ref] but may have a benefit on cardiovascular function [ref]
  • AG: 50% reduction in AMP Deaminase function [ref]
  • GG: normal type
The rs17602729 variant is also known as C34T in studies. Reading through studies on it, you will see the variant listed as T, but in 23andMe data, it will be shown as A.

Exercise studies:

A recent study found that those with an A allele “require longer rest periods between bouts of weight training, require longer between sessions and have increased perceived pain post training”. 

In a study of elite triathlon athletes, AMPD1 was found to be the only significant genetic factor for performance time.

A study of Lithuanian athletes found no athletes with the AA genotype and that the AG genotype likely affected anaerobic performance more than aerobic performance.

A study of elite rowers also found that the A allele was found much less often in the group.

One report sums up the exercise impact this way: “The frequency of the mutant allele is 8–11% in sedentary Caucasians, with only 2% of the population being homozygous for this mutation (20% are heterozygous) [14]. AMPD muscle activity is greatly diminished even in heterozygous individuals, reaching only ~39% activity of healthy controls [11]. Furthermore, in some heterozygotes, AMPD activity has been reported to be as low as 16% of its normal activity [15]. As a result, deleterious effects on exercise capacity associated with the C34T mutation have been reported, even in heterozygotes.”

Infection / Endotoxin studies:

study of healthy males given endotoxin (e. Coli) found that those with the AMPD1 polymorphism had higher adenosine levels, but the higher levels did not protect against subclinical organ damage.

While not associated with susceptibility to infection, a study of pneumonia patients found that the AMPD1 polymorphism “is associated with more pronounced immunoparalysis in patients with sepsis, and shows a tendency towards increased mortality”.

Rheumatoid arthritis /methotrexate studies:

A study found that AMPD1 deficiency is associated with the response to methotrexate in rheumatoid arthritis. [study]

The AMPD1 polymorphism is associated with a good response to methotrexate according to this study.

Heart Disease:

According to this 2015 study in a Malaysian population, AMPD1 polymorphisms may play a significant role in hypertension.

This meta-study looks at the generally beneficial role of the AMPD1 polymorphism in heart disease.

Another study found that being heterozygous for the AMPD1 variant led to better prognosis in cardiovascular disease [study


Lifehacks

Ribose has been suggested in several studies and in online forums for AMPD1 deficiency.  It can be purchased through Amazon and at health food stores. It is a white powder and is a type of simple sugar. Some people with blood sugar regulation problems report having problems with hypoglycemia when taking it.

Creatine supplements have also been used for AMPD1 deficiency.  Studies have shown varying results for the impact of creatine.  [study] [study]

More to read:

Athletic Performance Genes

 

(originally published May 2017, revised and updated Sept. 2019)

Gingivitis and Your Genes

Have you ever gone to the dentist, expecting a good report, only to be fussed at by the hygienist for bleeding gums? You brushed, flossed, and stayed away from candy for the past six months — so why on earth do you still have inflamed gums?

Gingivitis:

Inflammation of the gums is known as gingivitis. It is caused by an inflammatory response in the tissue of your gums. Periodontal disease is another term you may have heard mentioned by your hygienist (as she stabs your gums with the sharp poking tool). Periodontal disease is a term that includes gingivitis and then the next step – inflammation of the jaw bone and loose teeth. [ref]

So what causes gingivitis? Lack of brushing and flossing…  maybe. Smoking, for sure.

But what if you do regularly brush and floss? And what about those people (you know who you are) who don’t brush and floss but have healthy gums?

The key here is the body’s response to the bacteria and biofilm on the teeth.  The mouth is teeming with bacteria, and your immune system is on high alert to keep those bacteria from crossing into the bloodstream.

This isn’t just about a little bleeding when you brush or floss… Gingivitis is also connected to an increased risk of heart disease. This connection may be due to increased systemic inflammation.[ref]

People with gingivitis have higher CRP levels on average than people without gingivitis. And people with periodontitis had even higher CRP levels. [ref]


Genetic variants associated with gingivitis

TNF-α (Tumor necrosis factor-alpha) gene:
TNF-α is an inflammatory cytokine involved in the body’s immune response. TNF is important to have in the right amounts.  It helps the body to destroy cells with aberrant DNA, but too much TNF is implicated in inflammatory diseases such as rheumatoid arthritis.  TNF-α is stimulated by bacterial endotoxin (lipopolysaccharide) as well as other pathogens.  It is one of the body’s primary mediators in protection against bacteria and viruses.  Chronically elevated levels of TNF are implicated in a variety of autoimmune diseases.

Check your genetic data for rs1800629 (23andMe v4, v5; AncestryDNA):

  • A/A: 2 to 3-fold increase in TNF-α; increased risk of periodontitis [ref]
  • A/G: increased TNF-α; increased risk of periodontitis
  • G/G: normal

IL1A gene (Interleukin 1) and IL1B gene:
Interleukin 1 is another inflammatory cytokine produced by lymphocytes or monocytes and released in response to endotoxins.

Check your genetic data for rs1800587 (23andMe v4, v5; AncestryDNA):

  • A/A: increased IL1A[ref]; increased risk of gingival bacterial colonization[ref] increased risk of periodontitis [ref]
  • A/G: increased risk of gingival bacterial colonization
  • G/G: normal

Check your genetic data for rs1143634 (23andMe v4, v5; AncestryDNA):

  • A/A: increased risk of gingivitis [ref][ref][ref]
  • A/G: increased risk of gingivitis
  • G/G: normal

IL-6 gene:
Interleukin 6 acts both as inflammatory cytokine and as an anti-inflammatory signal by moderating TNF-alpha. This is another cytokine that is important in infection but can also become a problem if it is not regulated well by the body.  [read more]

Check your genetic data for rs1800795  (23andMe v4, v5; AncestryDNA):

  • G/G:  normal risk of gingivitis
  • C/G: normal risk of gingivitis
  • C/C: higher risk of gingivitis and periodontitis [ref] [ref]

IL8 gene:

Interleukin 8 is an important regulator of inflammatory response.

Check your genetic data for rs4073 (23andMe v4, v5; AncestryDNA):

  • A/A: increased IL8, somewhat increased risk of periodontitis [ref]
  • A/T: probably normal risk of periodontitis[ref]
  • T/T: normal

IL10 gene:
The IL10 gene codes for the IL-10 (interleukin-10) anti-inflammatory cytokine. Variants that cause a decrease in the amount of IL10 are associated with increased inflammation. In contrast, variants that cause an increase in IL10 are associated with less inflammation.

Check your genetic data for rs1800896 (23andMe v4, v5; AncestryDNA):

  • T/T: Common genotype, more likely to have gum disease
  • C/T:  more likely to have gum disease
  • C/C: higher IL-10, less likely to have gum disease [ref]

CCR5 gene:
The CCR5Δ32 variant is also linked with reduced mortality risk from HIV for people with one copy. Carriers of two copies of the mutation are resistant to common strains of HIV.

Check your genetic data for rs333 (23andMe – i3003626 v4,v5):

  • Insertion/Insertion  (either II or GTCAGTATCAATTCTGGAAGAATTTCCAGACA/ GTCAGTATCAATTCTGGAAGAATTTCCAGACA): normal
  • Insertion / Deletion (either DI or -/GTCAGTATCAATTCTGGAAGAATTTCCAGACA):  decreased risk of periodontitis.
  • Deletion / Deletion (either DD or -/-): decreased risk of periodontitis.[ref]

 


Lifehacks for reducing gingivitis

Here are some natural options to explore for reducing inflammation in your gums:

It almost goes without saying (but I’m saying it anyway) that good oral hygiene measures such as brushing your teeth are always important.

Natural TNF inhibitors include quercetin, resveratrol, and turmeric (curcumin). Studies show that resveratrol and curcumin specifically reduce the progression of periodontitis. [ref][ref]  You can get resveratrol as a supplement on Amazon or at your local health food store.  You can also get curcumin as a supplement or through incorporating the spice turmeric into your diet.

Glycine, found in bone broth, was found in a study to inhibit TNF-α due to endotoxins.[ref]

Swish with some green tea? A study found that using green tea as a mouthwash worked better for reducing gingivitis than chlorhexidine gluconate (germicidal mouthwash). [ref]

Although fluoride is added to toothpaste and municipal water supplies to prevent cavities, it also increases TNF-alpha expression. A study shows that serum TNF-α increases in response to sodium fluoride, but that curcumin and selenium can mitigate part of that elevation.[ref] Other studies also show that fluoride increased inflammatory cytokines including TNF-α, IL-1β, and IL-6.[ref][ref] [ref] Does this mean that you should stop drinking fluoridated water and use toothpaste without fluoride? I don’t know. I’ll let you read through the research and decide for yourself.

Getting enough vitamin C in your diet is important for gum and tooth health. One of the first symptoms of scurvy is swollen gums and loose teeth. But what about in our modern era when scurvy is practically non-existant? It turns out that low intake of vitamin C has been shown in several studies to increase the risk of periodontitis. [ref][ref][ref]  Foods rich in vitamin C include sweet peppers, citrus fruits, peaches, and broccoli. Not into fruits and vegetables? A bag of Skittles gives you 69% of the RDA for vitamin C. (Skittles are definitely not recommended for dental health, even though they have vitamin C :-) [ref]

Rinsing with saltwater actually may help with gingivitis. In fact, saline rinses have been used (in China) since 2700 BC. The study on saline shows that it increased type-I collagen and fibronectin in gingivitis cells. [ref]

 

 

How to delete your 23andMe account

23 and Me offers an easy way to delete your account and remove your data from their website.

First, I highly suggest that you download your 23andMe raw data file. If you delete your 23andMe account, you will not (of course) be able to use your genetic data unless you have downloaded the file.

To delete your account, click on your name in the upper right corner, and then choose Settings.

Scroll down to the bottom of the Settings page. Here you will see:

Click on the word “View”.

This will take you to a page with all your data options.  Scroll to the bottom.

Click on the big red “Permanently Delete Data” button.  This will trigger an email confirmation to whatever email address you used when you registered with 23andMe.  The email confirmation comes fairly quickly, so if you don’t see it within an hour, be sure to check your spam.

Once you confirm that you want your data deleted, it can take up to a month before all of your data – genetic, personal info, tracking data – is deleted from their servers.

 

 

Living to 100: Longevity and Genetics

There are several genes known as “longevity” genes that increase your odds of becoming a centenarian. Specific variants of these genes are associated with an increased likelihood of living to be 100 or more. And…  more importantly, these genetic variants are linked to longer ‘healthspan’.

Longevity:

The term longevity refers to lifespan. People in the US, on average, live to a little over 80 years of age, but some people live to 100+ and are still relatively healthy. You may immediately assume that everyone who lives longer did everything right- exercised, meditated, ate the very best diet, etc – but that isn’t necessarily the case. Researchers estimate that about 25% of the variation in lifespan is due to genetics. [ref]

What does it take to live a long, healthy life? Avoiding smoking, not drinking too much alcohol, and not getting cancer are all important for the first 80 years. Beyond that, genetics becomes more important.

What if you don’t have the longevity gene variant? Understanding the genes involved in longevity points to some ‘lifehacks’ for increasing healthy aging for everyone.

What are the odds of living to 100?
Someone born a hundred years ago has less than 1% chance of being alive today. In contrast, if you are female and born in 1973 (46 years old), your odds of living to 100 are 20%. (Wondering about the odds for your birth year?  Here is a nice chart of your odds of living to 100 based on your birth year.)

Thus, if your odds of living to 100 are 20%, a genetic variant that increases that doubles the odds is fairly significant! Retirement planning is a must :-)

Keep in mind, though, that while genetics does play a role in how long you live, there are lots of other health and lifestyle factors that are also important. This is just about statistics here.

What needs to go on at a cellular level for healthy aging?
Cells accumulate damage and get replaced all the time, at any age. The cells in your intestines turn over fairly quickly, with a cellular turnover rate of 2-6 days. Fat cells turnover every 8 years. Contrast this with brain cells, most of which are never replaced. [ref] [ref]

When cells divide, the DNA needs to be copied correctly. Yep – mitosis, you learned about it in high school biology. Errors in that DNA copy mechanism occur, and if the errors aren’t corrected, that cell may need to go through apoptosis (cell death).  DNA errors that occur in specific genes are what leads to cancer…  Avoiding cancer is important for longevity.

One way to increase lifespan in animals in a lab is to decrease calories. This has been shown in numerous studies with lots of different types of animals — except humans. A couple of the theoretical reasons for why calorie restriction increases lifespan include the changes to IGF1 (insulin-like growth factor 1) and autophagy.[ref] Autophagy is the cellular process of cleaning up damaged organelles and recycling cellular waste.

When it comes to the genetic variants that are linked with greater longevity, researchers show that genes involved in apoptosis, tumor suppression, regulating growth, and heart health are important.


Genetic variants associated with longevity:

FOXO3A gene:
The FOXO3A gene (forkhead box O3) has been linked to longevity in several different studies. This gene is believed to regulate apoptosis (cell death) and function as a tumor suppressor. It is also involved in nutrient sensing and the response to oxidative stress.[ref][ref]

Check your genetic data for rs2802292 (23andMe v.4, v.5; AncestryDNA):

  • G/G: Increased odds of living longer (1.5 to 2.75-fold increased odds) [ref][ref]
  • G/T: increased odds of living longer
  • T/T:  Normal

Check your genetic data for rs1935949 (23andMe v.4, v.5; AncestryDNA):

  • A/A: Increased longevity for women [ref]
  • A/G: increased longevity for women
  • G/G: normal

Check your genetic data for rs479744 (AncestryDNA only):

  • T/T: somewhat higher probability of increased longevity[ref]
  • G/T: somewhat higher probability of increased longevity
  • G/G: normal

CETP Gene:
Another gene related to longevity is the CETP gene (cholesteryl ester transfer protein) which is involved in exchanging triglycerides with cholesteryl esters.  One polymorphism that is related to longevity is rs5882 (also referred to as I405V).  The G allele is associated with a somewhat longer lifespan, lower odds of dementia (including Alzheimer’s), and higher HDL levels. [study]

Check your genetic data for rs5882 (23andMe v4, v5; AncestryDNA):

  • G/G: Longer lifespan, higher HDL cholesterol, significantly decreased risk of dementia and Alzheimer’s[ref][ref]
  • A/G:  Longer lifespan, higher HDL cholesterol
  • A/A:  Normal

IGF1R gene:
The IGF1R gene codes for the insulin-like growth factor 1 receptor. IGF1 is a hormone that signals for growth and anabolic activities. Growth hormone levels generally fall as we age.

Check your genetic data for rs2229765 (23andMe v4, v5; AncestryDNA):

  • A/A: lower IGF levels, increased longevity[ref][ref]
  • A/G: normal longevity
  • G/G: normal

TP53 gene:
This gene codes for a protein that is important in tumor suppression.

Check your genetic data for rs1042522 (23andMe v4, v5):

  • G/G: increased longevity (possibly due to increased cancer survival) [ref]
  • C/G: slightly increased longevity
  • C/C: normal

Lifehacks

Carrying the genes that increase my chance of living to 100 has changed my attitude and way of thinking about getting older. Planning for retirement suddenly became even more important.

Diet hacks:

The Okinawan Diet is thought to promote healthy longevity, in part, through affecting FOXO3. The diet focuses on fresh vegetables, fish, lean meats, omega-3 fats, and unrefined carbohydrates.

Ketosis is theorized to decrease IGF1 and enhance FOXO3. It is thought that a ketogenic diet – or intermittent/periodic fasting will increase longevity. [ref][ref]

Supplements and Foods:

Green tea polyphenols (EGCG) have been found to increase FOXO3 levels.

Astaxanthin, which is naturally found in shrimp, salmon, and red algae, has been found to increase FOXO3 levels.[ref] If you aren’t getting enough astaxanthin from your diet, you can get it as a supplement.

Berberine is a supplement often used for blood glucose regulation. Research shows that it may enhance FOXO3A. [ref]  You can get berberine as a supplement on Amazon or at your local health food store.

 

More to read:

 

Originally published: Mar 2015. Revised and updated: Aug 2019.

Snips about SNPs: Low LDL Cholesterol

Low LDL cholesterol throughout life and a decreased risk of heart disease? Sign me up! No, this isn’t the latest pill from a pharmaceutical company, but a genetic variant that some people have.

The PCSK9 gene codes for an enzyme that is important in controlling the amount of cholesterol in the bloodstream.  Some people carry a genetic variant in the PCSK9 gene that decreases their cholesterol levels. This is also associated with a decreased risk of heart disease!

Check your 23andMe data for rs11591147 R46L (v4, v5):

  • G/G: normal
  • G/T: decreased LDL-cholesterol, 30% lower risk of heart disease[ref] [ref]
  • T/T: decreased LDL-cholesterol, > 30% lower risk of heart disease

Want to learn more about other PCSK9 genetic variants? Check out the full article on PCSK9. 

 

*SNP stands for Single Nucleotide Polymorphism, which is when one of the nucleotide bases (the A, C, G, or Ts) is replaced by a different nucleotide base in a gene. 

Want more quick bits about your genes? Read through all the Snips about SNPs

Tryptophan: Building serotonin and melatonin

For a lot of people, tryptophan brings to mind napping on the couch after eating a huge amount of Thanksgiving turkey. (Turns out that it isn’t really true that the tryptophan in turkey makes you sleepy – but the post Thanksgiving dinner nap phenomenon is definitely real at our house.) Tryptophan metabolism influences mood, sleep, neurotransmitters, and immune response.

What is tryptophan and why do we need it?

Tryptophan is an essential amino acid. ‘Essential’ here means that your body can’t produce it and thus you need to get tryptophan through your diet.

Once you consume tryptophan in foods, your body can use it through a couple of different pathways.

First, tryptophan can be used to make serotonin, which is a neurotransmitter in the brain and in the intestines. Serotonin is the precursor for melatonin, so tryptophan eventually can become melatonin (thus the tie into being sleepy from the Thanksgiving turkey).

The other pathway that uses tryptophan is the kynurenic acid pathway. This eventually leads to tryptophan being converted into niacin. But there are lots of steps along the way and intermediate molecules with a variety of implications for mental health.

tryptophan pathway

Kynurenine pathway:

Tryptophan can be converted to kynurenine, and >90% of tryptophan that isn’t used for protein synthesis goes down this pathway.  This occurs with the help of the  IDO (indoleamine 2,3-dioxygenase) enzymes, which are expressed throughout the body, and the TDO enzyme in the liver. [ref]

The IDO enzymes are induced by inflammatory cytokines, such as interferon-gamma. So inflammation may cause tryptophan to be used even more for kynurenine and less for serotonin.

Most commonly, tryptophan is converted to kynurenine by the TDO (tryptophan 2,3 dioxygenase) enzyme. This is mainly expressed in the liver and is induced by cortisol (stress) and steroids. [ref]

Thus, when you are stressed with high cortisol levels or when you are fighting off a pathogen, the kynurenine pathway will dominate, with little tryptophan available for conversion to serotonin.

The metabolites, or what kynurenine is broken down into, are a key to the effects from shunting tryptophan towards this path. For the most part, I will focus on the effects of these metabolites in the brain.

Quinolinic acid:
Kynurenine can be converted, through a couple of intermediate steps, to quinolinic acid.  Quinolinic acid is a neurotoxin that binds to the NMDA receptor. It causes neurodegeneration and apoptosis. It is unable to pass through the blood-brain barrier, so it is only neurotoxic to the brain when produced in the brain by macrophages or microglial cells (as long as the blood-brain barrier is intact).[ref]

Too much quinolinic acid in the brain is associated with Alzheimer’s disease, ALS, Huntington’s, autism, depression, and suicide attempts. The excess quinolinic acid in the brain causes overactivation of the NMDA receptor. This leads to oxidative stress, not enough energy in the brain, and eventual cell death of the neurons. [ref][ref]

The link between quinolinic acid and depression has been the subject of quite a few recent research papers. One 2016 paper theorizes that a cause of depression may be due to tryptophan metabolism being shunted to the kynurenine pathway – which could increase quinolinic acid and, at the same time, decrease serotonin. This shift would be promoted by either an inflammatory response and/or stress hormones, both of which activate the IDO enzyme.[ref][ref] There are quite a few studies linking inflammation with depression and bipolar disorder, and some studies that include data showing the kynurenine pathway activation.[ref][ref]

Niacin:
Quinolinic acid is converted by the body into NAD+ (nicotinamide adenine dinucleotide), which is used in the mitochondria in the production of ATP. Magnesium is a co-factor in this conversion. (We also get niacin through our diet.)

Serotonin – Melatonin Pathway:

Your body also uses tryptophan to make the neurotransmitter serotonin. While we often think of serotonin as a happy molecule in the brain, it also acts as a neurotransmitter elsewhere in the body, such as in the intestines.

The TPH2 enzyme is the limiting factor in converting tryptophan into serotonin.

In the brain, serotonin needs to be made from tryptophan that has crossed the blood-brain barrier.  Tryptophan needs a transporter to cross the blood-brain barrier, and that transport is shared with other branch-chain amino acids.  So when tryptophan is consumed along with other protein, it often doesn’t reach the brain. That transport across the blood-brain barrier also needs insulin.

Depression, serotonin, and quinolinic acid:

While it is often thought that decreased serotonin in the brain causes depression, the science is not exactly cut-and-dried here. It turns out that it is really hard to measure serotonin levels in human brains. There is definitely a connection between biomarkers of serotonin and depression, and increasing serotonin can help with depression for some people… but it isn’t as simple as depression is caused by low serotonin for everyone. [ref][ref]

Researchers have created a mouse model of reduced TPH2 enzyme activity. They have shown that this significantly decreases serotonin levels in the brain and causes mouse depression and anxiety symptoms.[ref] And other researchers show that this decreased TPH2 activity causes mice to be susceptible to psychosocial stress.[ref]  Decreased serotonin synthesis in adult mice also causes circadian diruption and hyperactivity. [ref] Thus, tryptophan conversion in the brain into serotonin is likely to play some role in mood, anxiety, and circadian rhythm.

Keep in mind that one cause of tryptophan conversion being shunted away from serotonin and towards kynurenine is increased inflammation. This causes a double whammy – lower serotonin and higher quinolinic acid. Quinolinic acid acts on the NMDA receptors and too much can kill off brain cells.  Studies show that depression scores correlate to higher quinolinic acid in the blood, and postmortem studies show more cells in the brain producing quinolinic acid in suicide victims. [ref]

Don’t forget the gut microbiome…

The nice graphic up above that I made about the various ways the body can convert tryptophan leaves out one potentially big player in this game – the gut microbiome. Your gut bacteria can also use some of the same enzymes that your body makes in order to convert tryptophan into metabolites also. This makes my nifty flow chart all messy. [ref]

Dietary sources of tryptophan:

Estimated recommended daily intake for adults is between 250- 425 mg/day of tryptophan — so not a whole lot!  Most individuals get a lot more than this amount.  Common sources of tryptophan in the diet include oatmeal, bananas, milk, tuna, chicken, turkey, peanuts, chocolate, and cheese. [ref]

A study of 29,000 people found that even higher levels of tryptophan in the diet are not a problem for kidney or liver function. The study did find that higher tryptophan intake correlated to lower levels of depression and better sleep.[ref]

Pellagra:

A lack of niacin (vitamin B3) causes pellagra, which is a disease that causes diarrhea, dementia, and dermatitis. People get niacin either through eating foods that contain it or through converting tryptophan through the kynurenine pathway into niacin. Pellagra was a problem in the southern US after the Civil War due to nutritional deficiency of niacin and eating a lot of corn.  Corn doesn’t have tryptophan in it, and the niacin is bound up in such a way that it needs to be nixtamalized before eating it. This is why the native populations in Mexico soaked the corn with limewater (or another alkaline solution) before making tortillas.

Not only does corn lack tryptophan or bioavailable niacin, but it also contains a lot of leucine, which is a branched-chain amino acid (BCAA).  Leucine (and other BCAA) competes with tryptophan for uptake through the blood-brain barrier. Thus it is thought that high leucine along with low tryptophan contributes to pellagra.

 


Genetic Variants in the Tryptophan Genes:

Tryptophan -> Kynurenine

IDO1 gene: codes for the enzyme that converts tryptophan to kynurenine.

Check your genetic data for rs3808606 (23andMe  v4, v5; AncestryDNA):

  • A/A: decreased susceptibility to vaginal Candida, enhanced IDO1 [ref]
  • A/G: normal IDO1
  • G/G: normal IDO1
Check your genetic data for rs9657182 (23andMe v5; AncestryDNA):

  • C/C: more likely to have depression with IFN-alpha treatment[ref][ref]
  • C/T: intermediate effect
  • T/T: normal IDO1

KMO gene: codes for the enzyme that converts kynurenine to 3-OH-kynurenine

Check your genetic data for rs1053230 (23andMe v5; AncestryDNA):

  • C/C: normal genotype, higher risk of depression[ref]
  • C/T: increased 3-OH-kynurenine, decreased risk of bipolar with psychotic [ref]
  • T/T: increased 3-OH-kynurenine, decreased risk of bipolar with psychotic [ref]

Tryptophan -> Serotonin:

TPH2 gene: codes for the enzyme that converts tryptophan to 5-HTP, which then gets converted to serotonin in the brain.

Check your genetic data for rs4570625 (23andMe v4, v5; AncestryDNA):

  • G/G: (most common genotype for most populations), less tryptophan conversion to serotonin, slightly higher risk of ADHD [ref] a higher risk of depression, suicidal depression [ref][ref]
  • G/T: somewhat decreased risk of depression
  • T/T: generally decreased risk of depression [ref], less aggressiveness and lower anxiety [ref] lower neuroticism [ref]
Check your genetic data for rs11178997 (23andMe v4; AncestryDNA):

  • T/T: (most common genotype)
  • A/T: somewhat increased risk of depression
  • A/A: increased risk of depression and suicide [ref][ref]

Check your genetic data for rs1843809 (23andMe v5; AncestryDNA):

  • G/G: decreased risk of depression [ref]
  • G/T: decreased risk of depression
  • T/T: normal

Check your genetic data for rs1386494 (23andMe v5; AncestryDNA):

  • T/T:  better response to ECT [ref]
  • C/T: increased risk of depression
  • C/C: most common genotype, increased risk of depression[ref]

Check your genetic data for rs4290270 (23andMe v4; AncestryDNA):

  • T/T: circadian disruption in people with depression [ref]
  • A/T: most common genotype
  • A/A: higher risk of depression (Chinese study)[ref]

 

SLC6A4 gene: codes for the serotonin transporter

The serotonin transporter has a common variation that can either produce more (long form) or less (short form) of the transporter, known as 5-HTTLPR short or long (read more here).[ref]

People with the short-short version of the 5-HTTLPR were found in a study to impaired verbal recall when on a tryptophan depleted diet. Thus, the study concluded that dietary tryptophan levels are more important for people with the short-short version of the serotonin transporter. [ref]

To find out if you are likely to carry the 5-HTTLPR short version, check the following variants:

Look for the T allele on rs2129785 (23andMe v4, v5; AncestryDNA) combined with the A allele on rs11867581 (23andMe v4, v5; AncestryDNA).
T+A = 5-HTTLPR short version


Lifehacks:

Before we go any further, let’s talk about serotonin syndrome…
More is not always better, and too much serotonin can have detrimental effects. An overdose of serotonin can cause serotonin syndrome, which causes high body temperature, headache, diarrhea, tremor, sweating, increased heart rate, and seizures. The body temperature can reach 106 °F, which is life-threatening. Not something you want to experience!

What causes serotonin syndrome? Usually, it is the interaction between serotonergic drugs, such as MAOIs and SSRIs. Drugs such as fentanyl, tramadol, MDMA, and LSD may also interact to cause serotonin syndrome.  Some supplements, such as St. John’s Wort, Panax ginseng, and Yohimbe are also implicated. [ref]  Most cases of serotonin syndrome are caused by combining MAOIs and SSRIs.[ref] It is theoretically possible to supplement with enough 5-HTP to cause serotonin syndrome (animal studies show it), but there aren’t human studies showing that supplemental doses of 5-HTP cause serotonin syndrome.[ref] Nonetheless, if you are on an SSRI or MAOI, talk with your doctor before adding in more serotonin precursors.[ref]

Should you take tryptophan? or 5-HTP?
If you have variants above that impact your tryptophan pathway, you may be wondering about supplementing with either tryptophan or 5-HTP. Both are readily available as supplements.

You may want to use a whole lot of caution with adding in tryptophan or 5-HTP in the following situations:

  • For people with depression, the studies on adding in tryptophan in an effort to boost serotonin show mixed results. This could be because inflammation is pushing the tryptophan down the kynurenine pathway and increasing quinolinic acid at the same time as increasing serotonin. [ref]
  • If you are under a doctors care for depression, you could talk to your doc about whether adding in 5-HTP would be a benefit. This isn’t something to mess around with if you are already on an anti-depressant, especially without talking to your doctor.
  • Increasing serotonin in the gut may increase motility, which could be good or bad, depending on your situation.  Some people with IBS-D have higher serotonin levels in the gut, and blocking the serotonin receptor helps there.[ref] I don’t know for certain that supplementing with higher doses of tryptophan or 5-HTP would be detrimental with IBS-D, but it seems like that would be a distinct possibility.

Tryptophan for sleep:
For sleep, tryptophan has some pretty good studies showing that it increases melatonin. One study showed that tryptophan (476 mg) at breakfast increased melatonin production. This was enhanced by adding bright light exposure during the day. [ref] Another study found that eating foods high in tryptophan in the morning (bananas, fermented soybeans) along with decreasing blue-light exposure in the evening worked to increase melatonin production. Note that they didn’t actually block all blue light in the evening, just switch the overhead lights to incandescent (warm color) bulbs. [ref]

Finally, a one-week-long study of 1000 mg tryptophan/day found that it only improved sleep quality in people with the 5-HTTLPR short/short genotype.[ref]

If you decide to supplement with tryptophan, taking it with some carbs and without other protein sources should help it cross the blood-brain barrier. You can get it as a supplement either in capsules or as a powder.

Tryptophan for weight loss?
A study in lean men (why do they always study lean men!) found that 2 or 3 g doses of tryptophan 45 minutes before eating decreased food consumption at a buffet. It also decreased both hunger and alertness. [ref]

Another study found that tryptophan reduced stress eating only in people with the 5-HTTLPR short/short genotype. [ref]

Decreasing tryptophan conversion to serotonin: 

In mice, withaferin A (ashwagandha) downregulates TPH2. [ref]

Increasing tryptophan conversion to serotonin:
In addition to responding to inflammation or stress, the body also shunts more tryptophan towards the kynurenine pathway when niacin is low. [ref] Thus, ensuring that you get enough niacin may help to increase the conversion of tryptophan to serotonin (assuming no stress or inflammation). Foods that are rich in niacin include liver, chicken, pork, turkey, fish, soy, and pumpkin seeds.

Probiotics:
Taking lactobacillus Plantarum 299v may alter the amount of kynurenine produced. In a study of people with depression who were taking an SSRI, 8-weeks of taking the probiotic decreased kynurenine concentrations compared to a placebo group. It also improved cognitive function compared with placebo and baseline. [ref]  Lactobacillus Plantarum 299v is available on Amazon.

Snips about SNPs: Taste Receptors

Do you love dark chocolate and coffee? Both of them have bitter flavors that some people can taste – and some people cannot!  We have a bunch of different genes that code for different taste receptors. So different genetic variants of those taste receptor genes mean that foods don’t taste the same to everyone.

Check your genetic data for rs713598 (23andMe v.4 and v.5; AncestryDNA):

  • G/G: Can taste bitter in broccoli, dark chocolate, etc.
  • C/G: Probably can taste bitter
  • C/C: Unable to taste some bitter flavors

Want to learn more about your taste receptors? Check out the full article on taste receptors. 

 

*SNP stands for Single Nucleotide Polymorphism, which is when one of the nucleotide bases (the A, C, G, or Ts) is replaced by a different nucleotide base in a gene. 

Want more quick bits about your genes? Read through all the Snips about SNPs