Snips about SNPs: HIV resistance

Check your 23andMe for resistance to HIV

The CCR5 gene codes for a protein used by your immune system.  In order to hijack immune cells, the HIV virus uses CCR5 to sneak inside.

A mutation in CCR5 known as Delta 32 causes a change in the protein that makes it non-functional. Carrying two copies of the mutation protects most carriers from HIV. (The protection may not be 100% against different HIV strains, so don’t rely on this as a way not to get HIV.)

Why include this as a Snip about SNPs? It is an excellent example of why and how people have different susceptibility to infectious diseases.

C/CR5 Delta32 variant:

Check your 23andMe results for  i3003626 (v4, v5) also known as rs333:

  • Insertion / Deletion (either DI or -/GTCAGTATCAATTCTGGAAGAATTTCCAGACA):  a slower progression from HIV to AIDs, reduced mortality risk from HIV
  • Deletion / Deletion (either DD or -/-): resistance to the common strains of HIV [ref]

Learn more about the CCR5 delta 32 mutation.

*SNP stands for Single Nucleotide Polymorphism, which is when one of the nucleotide bases (the A, C, G, or Ts) is replaced by a different nucleotide base in a gene. 

Want more quick bits about your genes? Read through all the Snips about SNPs

Wishing that you had an easy way to know which Genetic Lifehacks articles apply to you? Get a Genetic Lifehacks Ultimate Cheat Sheet that matches your data to all of the articles available.

Subscribe to the Weekly Newsletter

* indicates required

Leave a Reply

Your email address will not be published. Required fields are marked *