The CCR5 gene codes for a protein used by your immune system. In order to hijack immune cells, the HIV virus uses CCR5 to sneak inside.
A mutation in CCR5 known as Delta 32 causes a change in the protein that makes it non-functional. Carrying two copies of the mutation protects most carriers from HIV. (The protection may not be 100% against different HIV strains, so don’t rely on this as a way not to get HIV.)
Why include this as a Snip about SNPs? It is an excellent example of why and how people have different susceptibility to infectious diseases.
CCR5 Delta32 variant:
Members: See your data below
Log in and select your data file Not a member? Join now.
Check your genetic data for rs333 (23andMe i3003626 v4, v5 ):
- Insertion/Insertion (either II or GTCAGTATCAATTCTGGAAGAATTTCCAGACA/ GTCAGTATCAATTCTGGAAGAATTTCCAGACA): normal and not resistant to HIV
- Insertion / Deletion (either DI or -/GTCAGTATCAATTCTGGAAGAATTTCCAGACA): a slower progression from HIV to AIDs, reduced mortality risk from HIV
- Deletion / Deletion (either DD or -/-): resistance to the common strains of HIV[ref]
Members: Your genotype for i3003626 is —.
Learn more about the CCR5 delta 32 mutation.
*SNP stands for Single Nucleotide Polymorphism, which is when one of the nucleotide bases (the A, C, G, or Ts) is replaced by a different nucleotide base in a gene.
Want more quick bits about your genes? Read through all the Snips about SNPs.