Snips about SNPs: HIV resistance

Check your 23andMe for resistance to HIV

The CCR5 gene codes for a protein used by your immune system.  In order to hijack immune cells, the HIV virus uses CCR5 to sneak inside.

A mutation in CCR5 known as Delta 32 causes a change in the protein that makes it non-functional. Carrying two copies of the mutation protects most carriers from HIV. (The protection may not be 100% against different HIV strains, so don’t rely on this as a way not to get HIV.)

Why include this as a Snip about SNPs? It is an excellent example of why and how people have different susceptibility to infectious diseases.

C/CR5 Delta32 variant:

Check your 23andMe results for  i3003626 (v4, v5) also known as rs333:

  • Insertion/Insertion  (either II or GTCAGTATCAATTCTGGAAGAATTTCCAGACA/ GTCAGTATCAATTCTGGAAGAATTTCCAGACA): normal and not resistant to HIV
  • Insertion / Deletion (either DI or -/GTCAGTATCAATTCTGGAAGAATTTCCAGACA):  a slower progression from HIV to AIDs, reduced mortality risk from HIV
  • Deletion / Deletion (either DD or -/-): resistance to the common strains of HIV [ref]

Learn more about the CCR5 delta 32 mutation.

*SNP stands for Single Nucleotide Polymorphism, which is when one of the nucleotide bases (the A, C, G, or Ts) is replaced by a different nucleotide base in a gene. 

Want more quick bits about your genes? Read through all the Snips about SNPs

Leave a Reply

Your email address will not be published. Required fields are marked *