Snips about SNPs: HIV resistance

The CCR5 gene codes for a protein used by your immune system. In order to hijack immune cells, the HIV virus uses CCR5 to sneak inside.

A mutation in CCR5 known as Delta 32 causes a change in the protein that makes it non-functional. Carrying two copies of the mutation protects most carriers from HIV. (The protection may not be 100% against different HIV strains, so don’t rely on this as a way not to get HIV.)

Why include this as a Snip about SNPs? It is an excellent example of why and how people have different susceptibility to infectious diseases.

CCR5 Delta32 variant:

Members: See your data below

Log in and select your data file Not a member? Join now.

Check your genetic data for rs333 (23andMe i3003626 v4, v5 ):

  • Insertion/Insertion  (either II or GTCAGTATCAATTCTGGAAGAATTTCCAGACA/ GTCAGTATCAATTCTGGAAGAATTTCCAGACA): normal and not resistant to HIV
  • Insertion / Deletion (either DI or -/GTCAGTATCAATTCTGGAAGAATTTCCAGACA):  a slower progression from HIV to AIDs, reduced mortality risk from HIV
  • Deletion / Deletion (either DD or -/-): resistance to the common strains of HIV[ref]

Members: Your genotype for i3003626 is .

Learn more about the CCR5 delta 32 mutation.

*SNP stands for Single Nucleotide Polymorphism, which is when one of the nucleotide bases (the A, C, G, or Ts) is replaced by a different nucleotide base in a gene. 

Want more quick bits about your genes? Read through all the Snips about SNPs


Related Articles and Topics:

What can you do with your 23andMe or AncestryDNA raw data?
Resources for using your raw genetic data file from 23andMe or AncestryDNA

Genetics on Reddit
Best places to learn more about current genetics research and 23andMe on Reddit

Mast cells: MCAS, genetics, and solutions
Mast Cell Activation Syndrome, or MCAS, is a recently recognized disease involving mast cells that misbehave in various ways. Symptoms of MCAS can include abdominal pain, nausea, itching, flushing, hives, headaches, heart palpitations, anxiety, brain fog, and anaphylaxis. Dive into the research on mast cells, genetics, and solutions.

Histamine Intolerance
Chronic headaches, sinus drainage, itchy hives, problems staying asleep, and heartburn — all of these symptoms can be caused by the body not breaking down histamine very well. Your genetic variants could be causing you to be more sensitive to foods high in histamine. Check your genetic data to see if this could be at the root of your symptoms.