Gingivitis and Your Genes

Have you ever gone to the dentist, expecting a good report, only to be fussed at by the hygienist for bleeding gums? You brushed, flossed, and stayed away from candy for the past six months — so why on earth do you still have inflamed gums?

Gingivitis:

Inflammation of the gums is known as gingivitis. It is caused by an inflammatory response in the tissue of your gums. Periodontal disease is another term you may have heard mentioned by your hygienist (as she stabs your gums with the sharp poking tool). Periodontal disease is a term that includes gingivitis and then the next step – inflammation of the jaw bone and loose teeth. [ref]

So what causes gingivitis? Lack of brushing and flossing…  maybe. Smoking, for sure.

But what if you do regularly brush and floss? And what about those people (you know who you are) who don’t brush and floss but have healthy gums?

The key here is the body’s response to the bacteria and biofilm on the teeth.  The mouth is teeming with bacteria, and your immune system is on high alert to keep those bacteria from crossing into the bloodstream.

This isn’t just about a little bleeding when you brush or floss… Gingivitis is also connected to an increased risk of heart disease. This connection may be due to increased systemic inflammation.[ref]

People with gingivitis have higher CRP levels on average than people without gingivitis. And people with periodontitis had even higher CRP levels. [ref]


Genetic variants associated with gingivitis

TNF-α (Tumor necrosis factor-alpha) gene:
TNF-α is an inflammatory cytokine involved in the body’s immune response. TNF is important to have in the right amounts.  It helps the body to destroy cells with aberrant DNA, but too much TNF is implicated in inflammatory diseases such as rheumatoid arthritis.  TNF-α is stimulated by bacterial endotoxin (lipopolysaccharide) as well as other pathogens.  It is one of the body’s primary mediators in protection against bacteria and viruses.  Chronically elevated levels of TNF are implicated in a variety of autoimmune diseases.

Check your genetic data for rs1800629 (23andMe v4, v5; AncestryDNA):

  • A/A: 2 to 3-fold increase in TNF-α; increased risk of periodontitis [ref]
  • A/G: increased TNF-α; increased risk of periodontitis
  • G/G: normal

IL1A gene (Interleukin 1) and IL1B gene:
Interleukin 1 is another inflammatory cytokine produced by lymphocytes or monocytes and released in response to endotoxins.

Check your genetic data for rs1800587 (23andMe v4, v5; AncestryDNA):

  • A/A: increased IL1A[ref]; increased risk of gingival bacterial colonization[ref] increased risk of periodontitis [ref]
  • A/G: increased risk of gingival bacterial colonization
  • G/G: normal

Check your genetic data for rs1143634 (23andMe v4, v5; AncestryDNA):

  • A/A: increased risk of gingivitis [ref][ref][ref]
  • A/G: increased risk of gingivitis
  • G/G: normal

IL-6 gene:
Interleukin 6 acts both as inflammatory cytokine and as an anti-inflammatory signal by moderating TNF-alpha. This is another cytokine that is important in infection but can also become a problem if it is not regulated well by the body.  [read more]

Check your genetic data for rs1800795  (23andMe v4, v5; AncestryDNA):

  • G/G:  normal risk of gingivitis
  • C/G: normal risk of gingivitis
  • C/C: higher risk of gingivitis and periodontitis [ref] [ref]

IL8 gene:

Interleukin 8 is an important regulator of inflammatory response.

Check your genetic data for rs4073 (23andMe v4, v5; AncestryDNA):

  • A/A: increased IL8, somewhat increased risk of periodontitis [ref]
  • A/T: probably normal risk of periodontitis[ref]
  • T/T: normal

IL10 gene:
The IL10 gene codes for the IL-10 (interleukin-10) anti-inflammatory cytokine. Variants that cause a decrease in the amount of IL10 are associated with increased inflammation. In contrast, variants that cause an increase in IL10 are associated with less inflammation.

Check your genetic data for rs1800896 (23andMe v4, v5; AncestryDNA):

  • T/T: Common genotype, more likely to have gum disease
  • C/T:  more likely to have gum disease
  • C/C: higher IL-10, less likely to have gum disease [ref]

CCR5 gene:
The CCR5Δ32 variant is also linked with reduced mortality risk from HIV for people with one copy. Carriers of two copies of the mutation are resistant to common strains of HIV.

Check your genetic data for rs333 (23andMe – i3003626 v4,v5):

  • Insertion/Insertion  (either II or GTCAGTATCAATTCTGGAAGAATTTCCAGACA/ GTCAGTATCAATTCTGGAAGAATTTCCAGACA): normal
  • Insertion / Deletion (either DI or -/GTCAGTATCAATTCTGGAAGAATTTCCAGACA):  decreased risk of periodontitis.
  • Deletion / Deletion (either DD or -/-): decreased risk of periodontitis.[ref]

 


Lifehacks for reducing gingivitis

Here are some natural options to explore for reducing inflammation in your gums:

It almost goes without saying (but I’m saying it anyway) that good oral hygiene measures such as brushing your teeth are always important.

Natural TNF inhibitors include quercetin, resveratrol, and turmeric (curcumin). Studies show that resveratrol and curcumin specifically reduce the progression of periodontitis. [ref][ref]  You can get resveratrol as a supplement on Amazon or at your local health food store.  You can also get curcumin as a supplement or through incorporating the spice turmeric into your diet.

Glycine, found in bone broth, was found in a study to inhibit TNF-α due to endotoxins.[ref]

Swish with some green tea? A study found that using green tea as a mouthwash worked better for reducing gingivitis than chlorhexidine gluconate (germicidal mouthwash). [ref]

Although fluoride is added to toothpaste and municipal water supplies to prevent cavities, it also increases TNF-alpha expression. A study shows that serum TNF-α increases in response to sodium fluoride, but that curcumin and selenium can mitigate part of that elevation.[ref] Other studies also show that fluoride increased inflammatory cytokines including TNF-α, IL-1β, and IL-6.[ref][ref] [ref] Does this mean that you should stop drinking fluoridated water and use toothpaste without fluoride? I don’t know. I’ll let you read through the research and decide for yourself.

Getting enough vitamin C in your diet is important for gum and tooth health. One of the first symptoms of scurvy is swollen gums and loose teeth. But what about in our modern era when scurvy is practically non-existant? It turns out that low intake of vitamin C has been shown in several studies to increase the risk of periodontitis. [ref][ref][ref]  Foods rich in vitamin C include sweet peppers, citrus fruits, peaches, and broccoli. Not into fruits and vegetables? A bag of Skittles gives you 69% of the RDA for vitamin C. (Skittles are definitely not recommended for dental health, even though they have vitamin C :-) [ref]

Rinsing with saltwater actually may help with gingivitis. In fact, saline rinses have been used (in China) since 2700 BC. The study on saline shows that it increased type-I collagen and fibronectin in gingivitis cells. [ref]

 

 



Wishing that you had an easy way to know which Genetic Lifehacks articles apply to you? Get a Genetic Lifehacks Ultimate Cheat Sheet that matches your data to all of the articles available.
 

Genetic Lifehacks Weekly Update

* indicates required

Leave a Reply

Your email address will not be published. Required fields are marked *