Key takeaways:
~ Gingivitis is caused by inflammation in your gum tissue.
~ Bacteria in the mouth causes the inflammation in the gums. Brushing and not smoking help to decrease inflammation.
~ Gum disease and oral health are linked to overall health, including heart disease and neurodegenerative diseases.
~ Genetic variants play a big role in how much inflammatory response you will have in the mouth. Targeting the right genes may help with gum disease.
What is Gingivitis?
Have you ever gone to the dentist, expecting a good report, only to be fussed at by the hygienist for bleeding gums? You brushed, flossed, and stayed away from candy for the past six months — so why on earth do you still have inflamed gums?
Inflammation of the gums, known as gingivitis, is caused by an inflammatory response in the tissue of your gums. Periodontal disease is another term you may have heard mentioned by your hygienist (as she stabs your gums with the sharp poking tool). Periodontal disease is a term that includes gingivitis and then the next step – inflammation of the jaw bone and loose teeth.[ref]
So what causes gingivitis? Lack of brushing and flossing… maybe. Smoking, for sure.
But what if you regularly brush and floss? And what about those people (you know who you are) who don’t brush and floss but have healthy gums?
The key here is the body’s response to the bacteria and biofilm on the teeth. The mouth is teeming with bacteria, and your immune system is on high alert to keep those bacteria from crossing into the bloodstream.
Inflammation, gingivitis, and genetics:
Some people naturally (genetically) are more prone to producing higher levels of inflammatory cytokines. This is a positive attribute when you are fighting off certain viruses or bacteria. But the flip side is that elevated inflammation causes a number of diseases – including gum disease.
Frequently, people with gingivitis have higher CRP levels on average than people without gingivitis. And people with periodontitis had even higher CRP levels.[ref]
Genetic studies reveal a lot about the underlying causes of diseases, including gingivitis and periodontal disease.
Variants that increase inflammatory cytokines, such as TNF-alpha, interleukin 1A (IL1A gene), interleukin 6 (IL6 gene), and interleukin 8 (IL8 gene), are all linked to increased risk of gingivitis.
Your body also has ways to mitigate inflammatory cytokine production. Interleukin 10 is one such mechanism for moderating the inflammatory response. Genetic variants that decrease IL-10 are thus linked to increased inflammation and an increased risk of periodontal disease.
An increased inflammatory response to bacteria causes inflammation in the gums – gingivitis or periodontal disease. And targeting the right genetic variants may help you stop the bleeding and receding gums.
Heart disease and Gingivitis:
This article isn’t just about a little bleeding when you brush or floss. Gingivitis and an increased risk of heart disease are strongly connected.
This connection may be due to increased systemic inflammation, or it may be due to bacteria entering the bloodstream when your gums bleed (flossing, brushing).[ref]
Resolving inflammation:
The resolution of inflammation – the shutting off of inflammatory cytokine production – is actually an active process. Certain lipid-based molecules called pro-resolving mediators are produced to both stop inflammatory cytokine production and also promote the healing process (stem cells, etc.). These lipid-based pro-resolving mediators are produced from DHA and EPA, which are found in marine oils.
This is a huge and really important topic that I encourage you to read all about: Specialized Pro-Resolving Lipid Mediators: Getting Rid of Chronic Inflammation.
Gingivitis Genotype Report:
Not a member? Join here. Membership lets you see your data right in each article and also gives you access to the member’s only information in the Lifehacks sections.
Your genetic variants in genes related to inflammatory cytokines can significantly increase your risk of having inflamed gums.
TNF-α (Tumor necrosis factor-alpha) gene:
TNF-α is an inflammatory cytokine involved in the body’s immune response. TNF is important to have in the right amounts. It helps the body destroy cells with aberrant DNA, but too much TNF is implicated in inflammatory diseases such as rheumatoid arthritis. TNF-α is stimulated by bacterial endotoxin (lipopolysaccharide) as well as other pathogens. It is one of the body’s primary mediators in protection against bacteria and viruses. Chronically elevated levels of TNF have implications for a variety of autoimmune diseases.
Check your genetic data for rs1800629 (23andMe v4, v5; AncestryDNA):
- A/A: 2 to 3-fold increase in TNF-α; increased risk of periodontitis[ref]
- A/G: increased TNF-α; increased risk of periodontitis
- G/G: typical
Members: Your genotype for rs1800629 is —.
IL1A gene (Interleukin 1) and IL1B gene:
Interleukin 1 is another inflammatory cytokine produced by lymphocytes or monocytes and released in response to endotoxins.
Check your genetic data for rs1800587 (23andMe v4, v5; AncestryDNA):
- A/A: increased IL1A[ref]; increased risk of gingival bacterial colonization[ref], increased risk of periodontitis[ref]
- A/G: increased risk of gingival bacterial colonization
- G/G: typical
Members: Your genotype for rs1800587 is —.
Check your genetic data for rs1143634 (23andMe v4, v5; AncestryDNA):
Members: Your genotype for rs1143634 is —.
IL2 gene: codes for interleukin-2, another inflammatory cytokine.
Check your genetic data for rs2069763 (s3andMe v4, v5)- IL2 – A is minor, c typical
- A/A: ~3x increased risk of chronic periodontitis[ref]
- A/C: typical risk
- C/C: typical
Members: Your genotype for rs2069763 is —.
IL-6 gene:
Interleukin 6 acts both as an inflammatory cytokine and as an anti-inflammatory signal by moderating TNF-alpha. This is another important cytokine in infection, but if the body does not control it well, it can also cause problems.[read more]
Check your genetic data for rs1800795 (23andMe v4, v5; AncestryDNA):
- G/G: higher risk of gingivitis (common allele in many population groups)[ref][ref]
- C/G: typical risk of gingivitis
- C/C: lower risk of gingivitis
Members: Your genotype for rs1800795 is —.
IL8 gene:
Interleukin 8 is an essential regulator of the inflammatory response.
Check your genetic data for rs4073 (23andMe v4, v5; AncestryDNA):
- A/A: increased IL8, somewhat increased risk of periodontitis[ref]
- A/T: probably normal risk of periodontitis[ref]
- T/T: typical
Members: Your genotype for rs4073 is —.
IL10 gene:
The IL10 gene codes for the anti-inflammatory cytokine IL-10 (interleukin-10). Variants causing a decrease in the amount of IL10 are associated with increased inflammation. In contrast, variants that cause an increase in IL10 are associated with less inflammation.
Check your genetic data for rs1800896 (23andMe v4, v5; AncestryDNA):
- T/T: Common genotype, more likely to have gum disease
- C/T: more likely to have gum disease
- C/C: higher IL-10, less likely to have gum disease[ref]
Members: Your genotype for rs1800896 is —.
CCR5 gene:
The CCR5Δ32 variant also has links to reduced mortality risk from HIV for people with one copy. Carriers of two copies of the mutation are resistant to common strains of HIV.
Check your genetic data for rs333 (23andMe – i3003626 v4,v5):
- Insertion/Insertion (either II or GTCAGTATCAATTCTGGAAGAATTTCCAGACA/ GTCAGTATCAATTCTGGAAGAATTTCCAGACA): typical
- Insertion / Deletion (either DI or -/GTCAGTATCAATTCTGGAAGAATTTCCAGACA): decreased risk of periodontitis.
- Deletion / Deletion (either DD or -/-): decreased risk of periodontitis.[ref]
Members: Your genotype for i3003626 is — or for rs333 is —.
Lifehacks for reducing gum disease:
The rest of this article is for Genetic Lifehacks members only. Consider joining today to see the rest of this article.
Member Content:
An active subscription is required to access this content.
Join Here for full access to this article, genotype reports, and much more!
Already a member? Log in below.
Related Articles and Topics:
Curcumin Supplements: Decreasing Inflammation
Have you heard that curcumin supplements offer a slew of health benefits? Discover the science behind how curcumin reduces inflammation for better outcomes in chronic diseases.
Should you increase your vitamin C intake?
Like most nutrients, our genes play a role in how vitamin C is absorbed, transported, and used by the body. It can influence your risk for certain diseases, and it can make a difference in the minimum amount of vitamin C you need to consume each day.
TNF-alpha: Inflammation and Your Genes
Do you feel like you are constantly dealing with inflammation? Joint pain, food sensitivity, etc.? Perhaps your body genetically gears towards a higher inflammatory response. Tumor necrosis factor (TNF) is an inflammatory cytokine that acts as a signaling molecule in our immune system. In an acute inflammatory situation, TNF-alpha plays an essential role in protecting us.
Mast cells: MCAS, genetics, and solutions
Mast Cell Activation Syndrome, or MCAS, is a recently recognized disease involving mast cells that misbehave in various ways. Symptoms of MCAS can include abdominal pain, nausea, itching, flushing, hives, headaches, heart palpitations, anxiety, brain fog, and anaphylaxis. Dive into the research on mast cells, genetics, and solutions.
References:
Andia, Denise C., et al. “Interleukin-8 Gene Promoter Polymorphism (Rs4073) May Contribute to Chronic Periodontitis.” Journal of Periodontology, vol. 82, no. 6, June 2011, pp. 893–99. PubMed, https://doi.org/10.1902/jop.2010.100513.
Andrade, Eric Francelino, et al. “Can Resveratrol Treatment Control the Progression of Induced Periodontal Disease? A Systematic Review and Meta-Analysis of Preclinical Studies.” Nutrients, vol. 11, no. 5, Apr. 2019, p. E953. PubMed, https://doi.org/10.3390/nu11050953.
Balappanavar, Aswini Y., et al. “Comparison of the Effectiveness of 0.5% Tea, 2% Neem and 0.2% Chlorhexidine Mouthwashes on Oral Health: A Randomized Control Trial.” Indian Journal of Dental Research: Official Publication of Indian Society for Dental Research, vol. 24, no. 1, Feb. 2013, pp. 26–34. PubMed, https://doi.org/10.4103/0970-9290.114933.
Cavalla, Franco, et al. “CCR5Δ32 (Rs333) Polymorphism Is Associated with Decreased Risk of Chronic and Aggressive Periodontitis: A Case-Control Analysis Based in Disease Resistance and Susceptibility Phenotypes.” Cytokine, vol. 103, Mar. 2018, pp. 142–49. PubMed, https://doi.org/10.1016/j.cyto.2017.09.022.
—. “CCR5Δ32 (Rs333) Polymorphism Is Associated with Decreased Risk of Chronic and Aggressive Periodontitis: A Case-Control Analysis Based in Disease Resistance and Susceptibility Phenotypes.” Cytokine, vol. 103, Mar. 2018, pp. 142–49. PubMed, https://doi.org/10.1016/j.cyto.2017.09.022.
Chen, Xing, et al. “Quantitative Assessment of the Associations between Interleukin-8 Polymorphisms and Periodontitis Susceptibility.” Journal of Periodontology, vol. 86, no. 2, Feb. 2015, pp. 292–300. PubMed, https://doi.org/10.1902/jop.2014.140450.
Corrêa, M. G., et al. “Systemic Treatment with Resveratrol and/or Curcumin Reduces the Progression of Experimental Periodontitis in Rats.” Journal of Periodontal Research, vol. 52, no. 2, Apr. 2017, pp. 201–09. PubMed, https://doi.org/10.1111/jre.12382.
Dashash, M., et al. “The Relationship between Interleukin-10 Gene Polymorphism at Position -1082 and Susceptibility to Gingivitis in Children.” Journal of Periodontology, vol. 76, no. 9, Sept. 2005, pp. 1455–62. PubMed, https://doi.org/10.1902/jop.2005.76.9.1455.
Domínguez-Pérez, Rubén Abraham, et al. “Association of Cytokines Polymorphisms with Chronic Peridontitis and Rheumatoid Arthritis in a Mexican Population.” Acta Odontologica Scandinavica, vol. 75, no. 4, May 2017, pp. 243–48. PubMed, https://doi.org/10.1080/00016357.2017.1280846.
Dominici, Roberto, et al. “Cloning and Functional Analysis of the Allelic Polymorphism in the Transcription Regulatory Region of Interleukin-1 Alpha.” Immunogenetics, vol. 54, no. 2, May 2002, pp. 82–86. PubMed, https://doi.org/10.1007/s00251-002-0445-9.
Huynh, Nam Cong-Nhat, et al. “Rinsing with Saline Promotes Human Gingival Fibroblast Wound Healing In Vitro.” PLoS ONE, vol. 11, no. 7, July 2016, p. e0159843. PubMed Central, https://doi.org/10.1371/journal.pone.0159843.
Jayaprakash, Deepika, et al. “Effect of Periodontal Therapy on C-Reactive Protein Levels in Gingival Crevicular Fluid of Patients with Gingivitis and Chronic Periodontitis: A Clinical and Biochemical Study.” Journal of Indian Society of Periodontology, vol. 18, no. 4, 2014, pp. 456–60. PubMed Central, https://doi.org/10.4103/0972-124X.138688.
Lang, N. P., et al. “Effect of Interleukin-1 Gene Polymorphisms on Gingival Inflammation Assessed by Bleeding on Probing in a Periodontal Maintenance Population.” Journal of Periodontal Research, vol. 35, no. 2, Apr. 2000, pp. 102–07. PubMed, https://doi.org/10.1034/j.1600-0765.2000.035002102.x.
Lee, Jung-Hoo, et al. “The Association of Dietary Vitamin C Intake with Periodontitis among Korean Adults: Results from KNHANES Ⅳ.” PLoS ONE, vol. 12, no. 5, May 2017, p. e0177074. PubMed Central, https://doi.org/10.1371/journal.pone.0177074.
Majumder, Poulami, et al. “Interleukin Gene Polymorphisms in Chronic Periodontitis: A Case-Control Study in the Indian Population.” Archives of Oral Biology, vol. 101, May 2019, pp. 156–64. PubMed, https://doi.org/10.1016/j.archoralbio.2019.03.015.
—. “Interleukin Gene Polymorphisms in Chronic Periodontitis: A Case-Control Study in the Indian Population.” Archives of Oral Biology, vol. 101, May 2019, pp. 156–64. PubMed, https://doi.org/10.1016/j.archoralbio.2019.03.015.
Moreira, P. R., et al. “Interleukin-6 Expression and Gene Polymorphism Are Associated with Severity of Periodontal Disease in a Sample of Brazilian Individuals.” Clinical and Experimental Immunology, vol. 148, no. 1, Apr. 2007, pp. 119–26. PubMed, https://doi.org/10.1111/j.1365-2249.2007.03327.x.
Padayatty, Sebastian J., and Mark Levine. “Vitamin C Physiology: The Known and the Unknown And.” Oral Diseases, vol. 22, no. 6, Sept. 2016, pp. 463–93. PubMed Central, https://doi.org/10.1111/odi.12446.
Reichert, S., et al. “Interleukin-2 -330 and 166 Gene Polymorphisms in Relation to Aggressive or Chronic Periodontitis and the Presence of Periodontopathic Bacteria.” Journal of Periodontal Research, vol. 44, no. 5, Oct. 2009, pp. 628–35. PubMed, https://doi.org/10.1111/j.1600-0765.2008.01173.x.
Schenkein, Harvey A., and Bruno G. Loos. “Inflammatory Mechanisms Linking Periodontal Diseases to Cardiovascular Diseases.” Journal of Clinical Periodontology, vol. 40, no. 0 14, Apr. 2013, pp. S51–69. PubMed Central, https://doi.org/10.1111/jcpe.12060.
Schulz, Susanne, et al. “Single Nucleotide Polymorphisms in Interleukin-1gene Cluster and Subgingival Colonization with Aggregatibacter Actinomycetemcomitans in Patients with Aggressive Periodontitis.” Human Immunology, vol. 72, no. 10, Oct. 2011, pp. 940–46. PubMed, https://doi.org/10.1016/j.humimm.2011.05.009.
Spittler, Andreas, et al. “Immunomodulatory Effects of Glycine on LPS-Treated Monocytes: Reduced TNF-α Production and Accelerated IL-10 Expression.” The FASEB Journal, vol. 13, no. 3, 1999, pp. 563–71. Wiley Online Library, https://doi.org/10.1096/fasebj.13.3.563.
Tada, Akio, and Hiroko Miura. “The Relationship between Vitamin C and Periodontal Diseases: A Systematic Review.” International Journal of Environmental Research and Public Health, vol. 16, no. 14, July 2019, p. 2472. PubMed Central, https://doi.org/10.3390/ijerph16142472.
Waugh, Declan Timothy. “Fluoride Exposure Induces Inhibition of Sodium/Iodide Symporter (NIS) Contributing to Impaired Iodine Absorption and Iodine Deficiency: Molecular Mechanisms of Inhibition and Implications for Public Health.” International Journal of Environmental Research and Public Health, vol. 16, no. 6, Mar. 2019, p. E1086. PubMed, https://doi.org/10.3390/ijerph16061086.
“What Is Interleukin 6?” News-Medical.Net, 22 Feb. 2011, https://www.news-medical.net/health/What-is-Interleukin-6.aspx.
Yan, Nan, et al. “Fluoride-Induced Neuron Apoptosis and Expressions of Inflammatory Factors by Activating Microglia in Rat Brain.” Molecular Neurobiology, vol. 53, no. 7, Sept. 2016, pp. 4449–60. PubMed, https://doi.org/10.1007/s12035-015-9380-2.
Zhao, Bo, and Ronghua Li. “The Association between Periodontitis and Interleukin-6 Genetic Polymorphism -174 G/C: A Meta-Analysis.” Archives of Oral Biology, vol. 96, Dec. 2018, pp. 13–20. PubMed, https://doi.org/10.1016/j.archoralbio.2018.08.007.