Viruses: Are you susceptible to the coronavirus, flu, and more

With all the recent news coverage of the outbreak in Wuhan, you may be wondering if you are susceptible to the coronavirus. While you may think everyone catches a virus if exposed, your genes are actually important here as to whether or not you will get sick.

Genetics, Susceptibility to the Coronavirus, and Viral Immunity

Our genome is shaped by the pathogens that our ancestors survived. This is really pretty cool – you carry specific genetic variants that were passed down to you from the ancestors who lived through diseases and epidemics.

Throughout history, humanity’s biggest threats for survival have been the microscopic pathogens that we now battle successfully with antibiotics, antifungals, vaccines, clean water, etc. All of the genetic variants that gave your ancestors a survival advantage in ages past are still written in your genome today.

Let me give you a few examples:

  • People who carry a sickle-cell anemia mutation are likely to have an ancestor who survived malaria.
  • One copy of a cystic fibrosis mutation could have protected your ancestors from dying from cholera.
  • The CCR5Δ32 variant is protective against HIV / AIDS.  It is theorized that it may also have protected against the black death in the Middle Ages.
  • About 20% of the population carries a variant that prevents them from secreting their blood type – and this also protects them from getting the norovirus and the rotavirus (aka the stomach flu). [ref]

Let’s take a look at how the immune system works — using the coronavirus as an example. Then I’ll bring in some of the other genetic variants that gave your ancestors superpowers to defeat tiny microbes.

How does the body protect against viruses?

Viruses are not considered to be living organisms because they don’t have a cellular structure. Instead, they have to get inside a cellular organism in order to reproduce. Biologists define viruses as small, infectious agents. They can infect your cells and then hijack your own cellular processes to replicate themselves. After replication they spread to other cells, causing more replication and cell death.

Your body has several lines of defense against pathogens – multiple ways to go to battle, defending the body from out of control viral or bacterial invaders. Just like the military has multiple branches (Army, Navy, Air Force, Marines) and specialized groups within those branches, your immune system has several ways of detecting, isolating, killing, and defending against pathogens.

First, the virus must enter the cell. Some viruses need a cell entry receptor to bind to in order to get into the cell.  This is the case with HIV, and a mutation in the cell entry receptor CCR5 can prevent HIV from entering a cell and replicating.

For this current coronavirus outbreak, initial publications indicate that the cell entry receptor for this coronavirus is the same as for the SARS virus – the ACE2 (angiotensin-converting enzyme 2) receptor. [ref – preprint] [ref]

For viral infections, interferons are the first wave of defenders. White blood cells produce several different types of interferons to act against a wide range of viruses. Interferons act in a couple of different ways:

  • Interferons are cytokines that signal to other cells to protect against the spread of the virus.
  • Interferons bind to interferon receptors in adjacent cells, which triggers changes in those adjacent cells in order to resist the viral infection. This basically produces a firewall around the cell that contains the viruses.
  • Interferons also stimulate the cells to produce antiviral enzymes.

Pattern recognition receptors are also a part of the innate immune system, which is how the body recognizes foreign invaders. There are several subtypes of pattern recognition receptors including Toll-like receptors (TLRs), nucleotide-binding oligomerization domain (NOD),  retinoic acid-inducible gene 1 (RIG-1) -like receptors, and the C-type lectin receptors (CLRs).  [ref]

These pattern recognition receptors are found on immune cells, such as macrophages and neutrophils, and they detect specific parts of a microbe (bacteria, virus, etc) and alert the immune system to attack it.

Two specific pattern recognition receptors are TLR3 and TLR4 (toll-like receptor 3/4), and these are what the body uses to identify the SARS coronavirus.  [ref][ref]

What exactly is the coronavirus?

This latest coronavirus outbreak in January 2020 isn’t the first coronavirus to scare everyone with headlines of ‘pandemic’ and ‘outbreak’.  Past coronavirus outbreaks include:

  • SARS – severe acute respiratory syndrome:  a coronavirus outbreak that started in 2002-2003, infecting 8,000 people with a 10% mortality rate.
  • MERS – Middle East respiratory syndrome: became prevalent in 2012 with a 35% mortality rate.

Other strains of the coronavirus, though, just cause common, cold-like symptoms. Most coronavirus strains are found in animals, but there have been human coronaviruses known since the 1960s.

Viruses change, creating new strains. And these altered strains can be carried by animals, as well as infecting humans. This current coronavirus outbreak is thought to originate in animals (possibly bats[ref]) and is now capable of spreading via human-to-human contact. [ref]

How do different genetic variants protect against pathogens?

Genes are the blueprint for the proteins that make up the various components of the immune system. You have genes that code for the proteins that act as cellular receptors, the different pattern recognition receptors, several types of interferon, the various cytokines needed to destroy the pathogens, cell signals, and more. It’s a complicated system that keeps us resilient and able to fight off various types of pathogens, including new viruses and bacteria.

Genetic variants can cause slight differences in how any single part of the immune system works. Each of us is unique – able to easily fight off certain foreign invaders and slightly more susceptible to others. As a whole, this makes the human population resilient and powerful. Some people may be more susceptible to certain pathogens while others may have a mutation that protects them against that specific foreign invader.

There are, of course, trade-offs.  Variants that give protection against a specific pathogen often have a downside such as increased cancer risk or increased risk of inflammatory conditions[ref][ref]. So if you are battling with an overactive immune response, just keep in mind that it may be the same genetic variant that helped an ancient ancestor to survive a leprosy outbreak and then reproduce, passing along the variant.

Which genetic variants protect against this new coronavirus?

Ha! It is way too soon to know that information for the coronavirus responsible for the current outbreak in Wuhan, China (2019-nCoV).

In the genetics section below are a couple of variants that influenced the susceptibility to the SARS coronavirus. But let me caution that is too soon to know if those variants would influence susceptibility to this new coronavirus strain.


Genetic variants that influence viral susceptibility:

While it is too soon to know who is more susceptible to the new coronavirus strain, there are many well-studied genetic variants that interact with other viruses.

Below are several examples of differences in viral susceptibility that you may find interesting. Note that this is just a sampling of the well-studied variants and not everything currently known to researchers.

Genetic variants that protect against the flu:

Influenza – the flu – can be caused by several different strains of the virus. It tends to change and trend with different strains going around periodically.

Interestingly, studies show that the majority of people exposed to a new flu strain don’t get the flu – they remain asymptomatic.[ref]

The H3N2 strain has been prevalent for the past few years.  Genetic variants in the cytokine producing interleukin genes have been found to alter people’s susceptibility to the flu. These variants don’t completely protect you from getting the flu -just statistically make it less likely that you will come down with it. You still need to take the usual precautions against the flu…  complications from the flu kill a lot of people each year. [ref]

The IL-1β gene codes for interleukin-1 beta, an inflammatory cytokine important in the immune response.

Check your genetic data for rs16944 (23andMe v4, v5; AncestryDNA):

  • A/A: typical risk for H3N2 flu
  • A/G: typical risk for H3N2 flu
  • G/G: less than half the risk for H3N2 flu [ref]

The IL-28 gene codes for interleukin-28.

Check your genetic data for rs8099917 (23andMe v4, v5; AncestryDNA):

  • T/T: typical risk for H3N2 flu
  • G/T: ~ half the risk for H3N2 flu
  • G/G: ~ half the risk for H3N2 flu

The TNF gene codes for the TNF-alpha cytokine, which is important in the immune response.

Check your genetic data for rs361525 (-238G/A) (23andMe v4 )

  • A/A: less TNF-alpha, increased risk of H1N1 flu and complications [ref]
  • A/G: typical immune response to the flu
  • G/G: typical flu response

Genetic variants that influence HIV susceptibility:

The CCR5 gene (chemokine receptor type 5) codes for a protein on the cell membrane.

Check your 23andMe results for  i3003626 (v4, v5) also known as rs333:

  • Insertion/Insertion  (either II or GTCAGTATCAATTCTGGAAGAATTTCCAGACA/GTCAGTATCAATTCTGGAAGAATTTCCAGACA): typical and not resistant to HIV
  • Insertion / Deletion (either DI or -/GTCAGTATCAATTCTGGAAGAATTTCCAGACA):  One copy of CCR5-delta 32 mutation; a slower progression from HIV to AIDs, significantly reduced mortality risk from HIV[ref] [ref]
  • Deletion / Deletion (either DD or -/-): Two copies of CCR5-delta 32 mutation; resistant to most strains of HIV [ref][ref][ref]

Genetic variants associated with general susceptibility to several common viruses:

The TLR3 gene codes for a part of the body’s pattern recognition response.

Check your genetic data for rs3775291 (23andMe v4, v5; AncestryDNA):

  • C/C: most common genotype
  • C/T: decreased risk of hepatitis B virus, decreased risk of dengue fever, decreased risk of herpes simplex virus type 2
  • T/T: decreased risk of hepatitis B [ref]; decreased risk of dengue fever[ref]; decreased risk of herpes simplex virus type 2[ref]

The CCL2 gene codes for an inflammatory cytokine involved in the recruitment of monocytes and other immune system cells needed at the site of an inflammatory response.

Check your genetic data for rs1024611 (23andMe v4, v5; AncestryDNA):

  • A/A: typical
  • A/G: typical risk of SARS
  • G/G: increased susceptibility to SARS coronavirus.[ref]

The MBL2 gene codes for mannose-binding lectin 2, which is part of the immune system that recognizes carbohydrate signatures from foreign pathogens.

Check your genetic data for rs1800450 codon 54 (23andMe v4, v5; AncestryDNA):

  • T/T: reduced mannose-binding lectin; increased susceptibility to SARS coronavirus [ref]; increased susceptibility to tuberculosis[ref]
  • C/T: somewhat reduced mannose-binding lectin; increased risk of SARS coronavirus [ref]
  • C/C: typical

Lifehacks for preventing viral illnesses

Obviously, the first steps in preventing contagious diseases are to wash your hands frequently and avoid being around people who are contagious. I mentioned above that antibiotics, antifungals, etc have been important in fighting off pathogens, but really – mankind took a huge step forward in resisting diseases with the implementation of basic hygiene, including simple hand washing (with soap) and having clean water.

Beyond the obvious –  what else actually works, according to research, for boosting your ability to fight off a virus?

Resveratrol has been shown in studies to inhibit viruses, including flu, Epstein-Barr, RSV, and other common viruses.  It is thought to inhibit viral replication. Cell studies show that resveratrol inhibits the MERS coronavirus, but it isn’t clear whether this holds true in people.[ref][ref]

Elderberry – specifically the species Sambucus FormosanaNakai – has been shown in cell studies to have antiviral activity against the coronavirus NL63 (not the Wuhan strain). The study found that the caffeic acid in the elderberry extract may block the virus from attaching and replicating. [ref]

Mushroom extracts from lions mane and reishi protect against the dengue virus — in cell studies. [ref] Reishi has long been used as an immune system booster. It has been shown in cell studies to inhibit the replication of enterovirus 71 (causes hand, foot, and mouth disease)[ref]  Cordyceps helps out with the flu – in mice. [ref]

Will drinking red wine (for the resveratrol, of course) and eating mushrooms prevent you from getting the coronavirus or anything else that is going around? Yeah… well…  Personally, I’m going to stick to frequent hand washing and avoiding sick people as my best bet for virus prevention.


Related Genes and Topics

Are you a non-secretor?
Your genes control the species of bacteria that live in your gut microbiome. And your gut microbiome can help defend against — or make you vulnerable to — diseases.  People who are non-secretors of their blood type due to a FUT2 variant are protected from getting the norovirus and rotavirus.

Familial Mediterranean Fever
Familial Mediterranean fever (FMF) is a genetic condition of inflammatory episodes that cause painful joints, pain in the abdomen, or pain in the chest, and is most often accompanied by a fever. FMF is often misdiagnosed as various pain-related conditions such as fibromyalgia, myofascial pain syndrome, or gouty arthritis.



Author Information:   Debbie Moon
Debbie Moon is the founder of Genetic Lifehacks. She holds a Master of Science in Biological Sciences from Clemson University. Debbie is a science communicator who is passionate about explaining evidence-based health information. Her goal with Genetic Lifehacks is to bridge the gap between scientific research and the lay person's ability to utilize that information. To contact Debbie, visit the contact page.