Viruses: Are you susceptible to the coronavirus, flu, and more

With all the recent news coverage of COVID-19, you may be wondering if you are susceptible to the novel coronavirus, SARS-CoV2. While your first thought may be that everyone catches a virus if exposed, your genes are actually important as to whether or not you will get sick from some viruses and bacteria.

This article dives into the science of viral immunity, explains how your genes are involved, and includes genetic variants that you can check in your genetic raw data to see about some of your own viral immunity genes.

Genetics, Susceptibility to the Coronavirus, and General Viral Immunity

Our genome is shaped by the pathogens that our ancestors survived. This is really pretty cool – you carry specific genetic variants that were passed down to you from the ancestors who lived through diseases and epidemics.

Throughout history, humanity’s biggest threats for survival have been the microscopic pathogens that we now battle successfully with antibiotics, antifungals, vaccines, clean water, etc. All of the genetic variants that gave your ancestors a survival advantage in ages past are still written in your genome today. Pretty cool to think about!

Let me give you a few examples:

  • People who carry a sickle-cell anemia mutation are likely to have an ancestor who survived malaria.
  • One copy of a cystic fibrosis mutation could have protected your ancestors from dying from a cholera outbreak.
  • The CCR5Δ32 variant is protective against HIV / AIDS.  It is theorized that it may also have protected against the black death in the Middle Ages.
  • About 20% of the population carries a variant that prevents them from secreting their blood type – and this also protects them from getting the norovirus and the rotavirus (aka the stomach flu). [ref] Think of this one as a superpower that you would want to have is stuck aboard a cruise ship where everyone is sick!

Let’s take a look at how the immune system works — using the coronavirus as an example.

Then I’ll bring in some of the other genetic variants that gave your ancestors superpowers to defeat tiny microbes.

How does the body protect against viruses?

Viruses are not considered to be living organisms because they don’t have a cellular structure. Instead, they have to get inside a cellular organism in order to reproduce. Biologists define viruses as small, infectious agents. They can infect your cells and then hijack your own cellular processes to replicate themselves. After replication they spread to other cells, causing more replication and cell death.

Your body has several lines of defense against pathogens – multiple ways to go to battle, defending the body from out of control viral or bacterial invaders. Just like the military has multiple branches (Army, Navy, Air Force, Marines) and specialized groups within those branches, your immune system has several ways of detecting, isolating, killing, and defending against pathogens.

First, the virus must enter the cell. Some viruses need a cell entry receptor to bind to in order to get into the cell. This is the case with HIV. A mutation in the cell entry receptor CCR5 can prevent HIV from entering a cell and replicating.

For this current coronavirus outbreak, research indicate that the cell entry receptor for this coronavirus is the same as for the original SARS virus – the ACE2 (angiotensin-converting enzyme 2) receptor. [ref – preprint] [ref] [ref]

For viral infections, interferons are the first wave of defenders. White blood cells produce several different types of interferons to act against a wide range of viruses. Interferons act in a couple of different ways:

  • Interferons are cytokines that signal to other cells to protect against the spread of the virus.
  • Interferons bind to interferon receptors in adjacent cells, which triggers changes in those adjacent cells in order to resist the viral infection. This basically produces a firewall around the cell that contains the viruses.
  • Interferons also stimulate the cells to produce antiviral enzymes.

Pattern recognition receptors are also a part of the innate immune system, which is how the body recognizes foreign invaders. There are several subtypes of pattern recognition receptors including Toll-like receptors (TLRs), nucleotide-binding oligomerization domain (NOD),  retinoic acid-inducible gene 1 (RIG-1) -like receptors, and the C-type lectin receptors (CLRs).  [ref]

These pattern recognition receptors are found on immune cells, such as macrophages and neutrophils, and they detect specific parts of a microbe (bacteria, virus, etc) and alert the immune system to attack it.

Two specific pattern recognition receptors are TLR3 and TLR4 (toll-like receptor 3/4), and these are what the body uses to identify the SARS coronavirus.  [ref][ref]

The HLA (human leukocyte antigen) genes code for part of what is called the major histocompatibility complex (MHC). These proteins are part of the adaptive immune system and present the antigens, or pieces of the virus, on the surface of a cell. These antigens are like a flag saying ‘the virus is here!’. There are two major division of the MHC – MHC class I and MHC class II. The class I antigens that are presented on the surface of the cell calls in killer T-cells to destroy the cell. Likewise, the class II antigens present their antigens to the T-lymphocytes, which stimulate antibodies.

What exactly is the coronavirus?

This latest coronavirus outbreak (causing COVID-19) isn’t the first coronavirus to scare everyone with headlines of ‘pandemic’ and ‘outbreak’.  Past coronavirus outbreaks include:

  • SARS – severe acute respiratory syndrome:  a coronavirus outbreak that started in 2002-2003, infecting 8,000 people with a 10% mortality rate.
  • MERS – Middle East respiratory syndrome: became prevalent in 2012 with a 35% mortality rate.

Other strains of the coronavirus, though, just cause cold-like symptoms. They go around every year, infecting a percentage of the population and being rather irritating. Most coronavirus strains are found in animals, but there have been human coronaviruses known since the 1960s and earlier.

Viruses change, creating new strains. And these altered strains can be carried by animals, as well as infecting humans. This current coronavirus outbreak is thought to originate in animals (bats[ref]) and is now capable of spreading via human-to-human contact. [ref]

How do different genetic variants protect against pathogens?

Genes are the blueprint for the proteins that make up the various components of the immune system. You have genes that code for the proteins that act as cellular receptors, the different pattern recognition receptors, several types of interferon, the various cytokines needed to destroy the pathogens, cell signals, and more. It’s a complicated system that keeps us resilient and able to fight off various types of pathogens, including new viruses and bacteria.

Genetic variants can cause slight differences in how any single part of the immune system works. Each of us is unique – able to easily fight off certain foreign invaders and slightly more susceptible to others. As a whole, this makes the human population resilient and powerful. Some people may be more susceptible to certain pathogens while others may have a mutation that protects them against that specific foreign invader.

There are, of course, trade-offs.  Variants that give protection against a specific pathogen often have a downside such as increased cancer risk or increased risk of inflammatory conditions[ref][ref]. So if you are battling with an overactive immune response, just keep in mind that it may be the same genetic variant that helped an ancient ancestor to survive a leprosy outbreak and then reproduce, passing along the variant.

This genetic uniqueness comes into play for all of the different aspects of the immune system – from the initial response by interferons to the toll-like receptors and then the HLA proteins that present the antigens on the surface of the cells.

The HLA system comes into play here, big time. There are more than 15,000 different HLA class I and class II alleles that have been identified by researchers so far. There is a huge diversity amongst individuals in their HLA types — and this is what gives the human population as a whole a way to survive new pathogens. Because of the dizzying array of different HLA types, it is likely that a portion of the population will be able to fight off novel viruses that have just evolved. [ref]

Which genetic variants protect against this new coronavirus?

It is way too soon to know that information for COVID-19.

In the genetics section below are a couple of variants that influence the susceptibility to the SARS coronavirus or MERS coronavirus.

The original SARS virus is very similar to the SARS-CoV2 virus. [ref]But, let me caution that it is too soon to know for sure whether those variants would influence susceptibility to this new coronavirus strain.

Clearing up some speculative mis-information from other genetics websites:

The ACE2 gene codes for the cell receptor that the coronavirus uses to gain access to the cell, and several other report-selling genetics companies are making a buck by speculating on ACE2 variants increasing the risk for COVID-19. This is pure conjecture on their part. Instead, let’s look at what studies on SARS patients show.

Several different studies on SARS patients showed that genetic variants in the ACE2 gene did NOT impact SARS susceptibility.[ref][ref]  Additionally, the common ACE gene variants have also been shown not to impact susceptibility to SARS coronavirus.[ref]


Genetic variants that influence viral susceptibility:

Members: Log in to see your data file Not a member? Join now.

While it is too soon to know who is more susceptible to the new coronavirus strain, there are many well-studied genetic variants that impacted SARS susceptibility – as well as with other viruses.

Genetic variants associated with susceptibility to  SARS coronavirus:

The HLA-DRB1 gene codes for a part of the innate immune response.  The HLA genes vary widely amongst individuals, and they are a big part of why people can respond differently to various pathogens. This HLA-DR variant was linked in two different studies with being found significantly less often in people with the original SARS virus. (On the flip side, the variant below increases the risk of certain autoimmune diseases.)

Check your genetic data for rs2187668 (23andMe v4, v5; AncestryDNA):

  • T/T: likely to carry two copies of DRB1*0301, significantly less likely to have SARS coronavirus [ref][ref]
  • C/T: likely to carry one copy of HLA-DRB1*0301, less likely to have SARS coronavirus.
  • C/C: typical

Members: Your genotype for rs2187668 is .

 

The CCL2 gene codes for an inflammatory cytokine involved in the recruitment of monocytes and other immune system cells needed at the site of an inflammatory response.

Check your genetic data for rs1024611 (23andMe v4, v5; AncestryDNA):

  • A/A: typical
  • A/G: typical risk of SARS coronavirus
  • G/G: increased susceptibility to SARS coronavirus.[ref]

Members: Your genotype for rs1024611 is .

 

The CD209 gene codes for receptor (known as DC-SIGN) that is found on the surface of dendritic cells and macrophages. In macrophages, which are a type of white blood cell, the DC-SIGN receptor is responsible for binding to mannose-type carbohydrates found on many viruses, bacteria, and fungi. (Interesting study that includes the link with Neanderthals, this gene, and viruses)

Check your genetic data for rs4804803 (23andMe v4, v5; AncestryDNA):

  • A/A: typical; slightly increased risk of poorer prognosis in SARS [ref]
  • A/G: increased susceptibility to malaria, increased risk of tuberculosis
  • G/G: increased susceptibility to malaria[ref] increased risk of tuberculosis[ref] increase severity in chronic hepatitis C [ref]

Members: Your genotype for rs4804803 is .

 

The MBL2 gene codes for mannose-binding lectin 2, which is part of the immune system that recognizes carbohydrate signatures from foreign pathogens.

Check your genetic data for rs1800450 codon 54 (23andMe v4, v5; AncestryDNA):

  • T/T: reduced mannose-binding lectin; increased susceptibility to SARS coronavirus [ref]; increased susceptibility to tuberculosis[ref]
  • C/T: somewhat reduced mannose-binding lectin; increased risk of SARS coronavirus [ref]
  • C/C: typical

Members: Your genotype for rs1800450 is .

 

The OAS1 gene codes for a protein that is induced by interferon. The OAS1 protein activates an enzyme that degrades viral RNA and inhibits the replication of the virus.[ref]

Check your genetic data for rs10774671 (23andMe v4; AncestryDNA):

  • A/A: reduced OAS1; increased risk of West Nile Virus [ref];
  • A/G: typical
  • G/G: typical;

Members: Your genotype for rs10774671 is .

Check your genetic data for rs2660 (23andMe v5; AncestryDNA):

  • A/A: typical
  • A/G: protective against SARS coronavirus [ref]
  • G/G: protective against SARS coronavirus[ref][ref]

Members: Your genotype for rs2660 is .

 

The MX1 gene codes for the myxovirus resistance A protein, which is an antiviral protein that is induced by interferon.

Check your genetic data for rs17000900 (23andMe v4; AncestryDNA):

  • A/A: lower risk for SARS coronavirus [ref]
  • A/C: lower risk for SARS coronavirus
  • C/C: typical

Members: Your genotype for rs17000900 is .

Genetic variants that protect against the flu:

Influenza – the flu – can be caused by several different strains of the virus. It tends to change and trend with different strains going around periodically. Interestingly, studies show that the majority of people exposed to a new flu strain don’t get the flu – they remain asymptomatic.[ref]

The H3N2 strain has been prevalent for the past few years.  Genetic variants in the cytokine-producing interleukin genes have been found to alter people’s susceptibility to the flu. These variants don’t completely protect you from getting the flu -just statistically make it less likely that you will come down with it. You still need to take the usual precautions against the flu…  complications from the flu kill a lot of people each year. [ref]

The IL-1β gene codes for interleukin-1 beta, an inflammatory cytokine important in the immune response.

Check your genetic data for rs16944 (23andMe v4, v5; AncestryDNA):

  • A/A: typical risk for H3N2 flu
  • A/G: typical risk for H3N2 flu
  • G/G: less than half the risk for H3N2 flu [ref]

Members: Your genotype for rs16944 is .

The IL-28 gene codes for interleukin-28.

Check your genetic data for rs8099917 (23andMe v4, v5; AncestryDNA):

  • T/T: typical risk for H3N2 flu
  • G/T: ~ half the risk for H3N2 flu
  • G/G: ~ half the risk for H3N2 flu

Members: Your genotype for rs8099917 is .

The TNF gene codes for the TNF-alpha cytokine, which is important in the immune response.

Check your genetic data for rs361525 (-238G/A) (23andMe v4 )

  • A/A: less TNF-alpha, increased risk of H1N1 flu and complications [ref]
  • A/G: typical immune response to the flu
  • G/G: typical flu response

Members: Your genotype for rs361525 is .

The CD55 gene codes for a protein that protects cells from complement attack.[ref]

Check your genetic data for rs2564978 (23andMe V4; AncestryDNA):

  • T/T: Increased risk of severe infection, increased mortality risk with H1N1 flu[ref][ref]
  • C/T: Typical flu response
  • C/C: Typical flu response

Members: Your genotype for rs2564978 is .

Genetic variants that influence HIV susceptibility:

The CCR5 gene (chemokine receptor type 5) codes for a protein on the cell membrane.

Check your 23andMe results for  i3003626 (v4, v5) also known as rs333:

  • Insertion/Insertion  (either II or GTCAGTATCAATTCTGGAAGAATTTCCAGACA/GTCAGTATCAATTCTGGAAGAATTTCCAGACA): typical and not resistant to HIV
  • Insertion / Deletion (either DI or -/GTCAGTATCAATTCTGGAAGAATTTCCAGACA):  One copy of CCR5-delta 32 mutation; a slower progression from HIV to AIDs, significantly reduced mortality risk from HIV[ref] [ref]
  • Deletion / Deletion (either DD or -/-): Two copies of CCR5-delta 32 mutation; resistant to most strains of HIV [ref][ref][ref]

Members: Your genotype for i3003626 is .

Genetic variants associated with general susceptibility to several common viruses:

The TLR3 gene codes for a part of the body’s pattern recognition response.

Check your genetic data for rs3775291 (23andMe v4, v5; AncestryDNA):

  • C/C: most common genotype
  • C/T: decreased risk of hepatitis B virus, decreased risk of dengue fever, decreased risk of herpes simplex virus type 2
  • T/T: decreased risk of hepatitis B [ref]; decreased risk of dengue fever[ref]; decreased risk of herpes simplex virus type 2[ref]

Members: Your genotype for rs3775291 is .

The IFIH1 gene codes for an interferon induced component that is critical for the body’s response to RNA viruses. IFIH1 is also known as MDA5.

Check your genetic data for rs1990760  (23andMe v4; AncestryDNA):

  • C/C:
  • C/T: increased IFIH1, decreased risk of several RNA viruses [ref]
  • T/T: increased IFIH1, decreased risk of several RNA viruses [ref] (increased risk of several autoimmune diseases)

Members: Your genotype for rs1990760 is .


Lifehacks for preventing viral illnesses

Obviously, the first steps in preventing contagious diseases are to wash your hands frequently and avoid being around people who are contagious. I mentioned above that antibiotics, antifungals, etc have been important in fighting off pathogens, but really – mankind took a huge step forward in resisting diseases with the implementation of basic hygiene, including simple hand washing (with soap) and having clean water.

Why does hand washing work so well for enveloped viruses such as the coronavirus? Enveloped viruses contain a lipid membrane around the virus, and that lipid (fat) is susceptible to the surfactant actions of soap.  Studies on other enveloped viruses, such as the cytomegalovirus, show that good hand washing with soap and water was as effective as hand sanitizer. Other studies, though, show that you may be a little better off with an iodine-based hand sanitizer for Ebola. [ref] [ref]

What else may work, according to research, for boosting your ability to fight off a virus?

Coronavirus Inhibitor Studies:

Bismuth has been shown in cell tests to inhibit the SARS coronavirus.[ref] This doesn’t seem to be tested in vivo, so I don’t know if it will hold true in humans with the coronavirus.  Bismuth is the active ingredient in PeptoBismol.

Resveratrol has been shown in studies to inhibit viruses, including flu, Epstein-Barr, RSV, and other common viruses.  It is thought to inhibit viral replication. Cell studies show that resveratrol inhibits the MERS coronavirus, but it isn’t clear whether this holds true in people.[ref][ref]

Elderberry – specifically the species Sambucus FormosanaNakai – has been shown in cell studies to have antiviral activity against the coronavirus NL63 (not the COVID-19 strain). The study found that the caffeic acid in the elderberry extract may block the virus from attaching and replicating. [ref]

How long does the corona virus stay on surfaces?

A study from March 10th (pre-print) shows that the COVI19 coronavirus can stay viable in the air for more than 2 hours. The coronavirus can also stay viable on copper for up to 4 hours, on cardboard for up to 24 hours, and on plastic or stainless steel for 2-3 days. [ref]

NSAIDs and viral pneumonia:

Studies show that taking NSAIDs (e.g. Advil, Aleve) is associated with an increase risk of complications with viral or community acquired pneumonia.[ref][ref]

General Virus Prevention:

Mushroom extracts from Lion’s mane and Reishi protect against the dengue virus — in cell studies. [ref] Reishi has long been used as an immune system booster. It has been shown in cell studies to inhibit the replication of enterovirus 71 (causes hand, foot, and mouth disease)[refCordyceps helps out with the flu – in mice. [ref]

Best Bet:

Will drinking red wine (for the resveratrol, of course) and taking elderberry extract prevent you from getting the coronavirus – or anything else that is going around?  Stick to frequent hand washing and avoiding sick people as the best bet for virus prevention.

 


Related Genes and Topics

COVID-19 Studies Related to Genetics
An annotated list of the preprints and studies that are related to SARS-CoV2 (COVID-19) and genetics.

Blood type and Coronavirus Susceptibility
Blood type may influence the statistical risk of COVID-19 in a population. Learn more about how blood type is linked to various disease risk and dig into the science of how it could influence coronavirus risk.

Circadian Rhythm and Immune Response
Your circadian rhythm influences your immune response. Learn how this rhythm controls white blood cell production and why melatonin is important in protecting against viral and bacterial infections.

Are you a non-secretor?
Your genes control the species of bacteria that live in your gut microbiome. And your gut microbiome can help defend against — or make you vulnerable to — diseases.  People who are non-secretors of their blood type due to a FUT2 variant are protected from getting the norovirus and rotavirus.

Familial Mediterranean Fever
Familial Mediterranean fever (FMF) is a genetic condition of inflammatory episodes that cause painful joints, pain in the abdomen, or pain in the chest, and is most often accompanied by a fever. FMF is often misdiagnosed as various pain-related conditions such as fibromyalgia, myofascial pain syndrome, or gouty arthritis.

 

Originally published 2/1/2020. Updated 3/11/2020.



Author Information:   Debbie Moon
Debbie Moon is the founder of Genetic Lifehacks. She holds a Master of Science in Biological Sciences from Clemson University and an undergraduate degree in engineering. Debbie is a science communicator who is passionate about explaining evidence-based health information. Her goal with Genetic Lifehacks is to bridge the gap between the research hidden in scientific journals and everyone's ability to use that information. To contact Debbie, visit the contact page.